JFIF,,ExifMM* " * 0 VF F N(1$ V2 z i  CanonCanon EOS 5D Mark III-'-'Adobe Photoshop CC 2015 (Macintosh)2016:01:28 09:46:19www.architectuurreportage.be"'0220 Β֒ ޒ  0000 d2015:12:18 15:33:312015:12:18 15:33:31ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋICC_PROFILE }xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|ICC_PROFILE } "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{ՑICC_PROFILE |{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmICC_PROFILE jmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"ICC_PROFILE pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:ICC_PROFILE N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$ Adobe Photoshop CC 2015 (Macintosh)2015-12-18T15:33:31www.architectuurreportage.be C      C  E" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ? l|AphB^k$'VJtX:;v:ր%x|֑mRE'ۺ{Tv*(lr8cK@ pc޲CH=qVwАsߏJ@70s75VExY@*;u.y ^{VHB @)Cx8BZm ]6֨BmcβC'˸jŤBdQ3ng/>Y3j-cUmߥ]N 7ræ黨 7 ~4Ԉޤs(JCWU]ˌ⫻g<=?79eZpqSY”@ϗC8Uy4nm$WQޙ79?Vxµ&F1tPP5/,}늻{EpT#+#ojE*p{bD8іsy9J.}ʺ"q Թ@ΐ34ӥqҺ֜t(6}99uONOqs?>X4b+sexjIxOoM>]9:uW1s6Y | Otdqֽ'j;醏O#1-N{WI6_ G+1duIr'+.+w~26?wޗ(\9:rףxYcQʭwi\r:WT*:tУcnǥm-wM}as\{-8]p)k@GT^:TeؔZ%Vڹ3 .RFՏZE+-{WefoCTK,]i0l~{?u~j yzsX ЎVw {qJci#>V$)Jqk5wۭzXGZ{xˑ⧔jL5=쓛sZp-Kxa^sdžd4|>PC z8~ ~;QQG'Kg"_y刟h+қKE\2X*ǥ>Q3tn=JKKX$s]$pU'wlާE5@~i( KlqM ՔkZO< FTq!+sS㧠l9z ĉċއ4!}(\Z>7m?=,mLV<mϸ5 P׵gLuiڅ0<~UH-t7WeGˎ:|<=iGֶV ަiR2+,^ wcchƲ>oG-˝j lZ͝@&Wң[1E֘.ThEoO= aӿg+71NzֺKB7t!Oϧ4=ROZRv9)R=:A7ֶˏʨ'3֤#.1Lx؁ ]%känϽ7~^h8v5^>}~r3T/h=,wvaGqS bÏBicmJ@Hڟ1Œfk^diZL5 ўG-¹<Үp}sT.qӭ; Ehj^`PspU{lI,CMFU*{݁pw=3My}xsh~W`9Eqk>i@AùK>ѷ=MUfIʄSz͞ Qw.~) ޴ eY+v͏8æz@r(<JE$ҫBvիks@jsQ&?ՀF*ZLBiU+* _L`Z /4&2ơM;mǵ9Ygdzt@2ךhzl) L_p'X1~IEuc85dCHOjϊL=jْ0NMKl[x rjqJ*,];vcT?*ܟVQ!Ǡc[K#wiZ{XmWLiokr$s&:~T%Ơs?:5Fc9O0ՍTHg\ӌȠW{wҀܘYO'=)w=p3U~ոi> (RKRzSk>I~>4XhV^֣i]U]Fz:l|h w.Gxgjq`;9y4##5ԯr5q n>߼?G$Jz.ڟ~^Vܣ3F=..^o*M`IU~ӏ¦].{;=Hн8U0ۻҺ@.}jFjm^ޡ~sոXZ5cmKksi7OҸ,7_V$Wlް~QvQ/VPx8#M{W-|5Ihڽz՛4n6]h mn+Jĵ[?xV|c?# A'vԁv4vy+4_O?<9+6Fnh1&gVMò_vH6!M6[(1odZxvHPP֊T9x ٺn+BhKlW/);O]ce'TVRb5' ݿϨs{y'n+>LNJs(fn$ǒsQ-cTz>ǮqZfiCl C7o֩zug(An7+O k]/Gs/`sY]d^i\Gvw Yr8K?yhH9ܴ5Σ1q)$ʏ5tm^PD>}PM& a85l{<2|j\?{Pg2zRA(E0jO;ҬPu\c?Jtq E-vw^rM7>1cݏG>N+ zKj(ڕW}pi{qƩrqOoܷMK"D&?P.hK]7hk/ҭ#U~*0z6q=]y/ާG2 2y|WlҀ4^>%R>Hۓp'օiAs-h1ðȧQ3ƨhJ>s֫O]AUp,ުzVElAӤ bi&<g~v* Y@ {U;qDFsǭWKe1Q\FϯJgwV& 8GG>̹MPxj&.]}+J1/;i$C;zTs@d'*ڍ.tA<\ 'TGJeo9ZjHvJ[MMN".NWi6  4ԕd9J?$YӚ]Fd=)vJq >2l(YۊknT0U99zU9n\Td;X XS@~^j+Ne4|*QՓzSV=j&ܹ攝uQ.c"hnxtc#1@QNAE`n>SVlU/_֚ P߷n>;05AcdO]?;/6=:TbIjnо]t6<\$ڨp9#Ԁ,OJuzvu}j$}*^bJ V`[jXΗO|YXj( S-hDPcO,/~nYݣoOր ͝\oh-?-Z?1O9Q鎴 q@jfG-9[ a44wk5%V]@I_' L:Vu[j$BU֟ 1i=9 LtƜ}*7o.3ґNNO|@4HS@&IZjjш/gHJn<:P TJ&;t4 v5Zyxj7?{hݱ˒m-jtS{ڀ4)@pTmN/9Z߼wZ˳9Q=݁/6sw' X ۗljv nCK.GzҸX]x+n2Ӗq9i6juJ9?B鏺:PVzӖOwsQٷ֗oր4mx_Jy5J"m5b;|x'SUP*{ι>3\7@9X&tXoj|@s(*ؠ 17|]BvB E`q@tҷ,EULZԵEU\>+jJt*JX!kN:U$фs*b?F{em@mڵ"PұQ7b:.'ZS(r 5TM.6  Xyҭ8r:T2;coJ@Q>m_KZnwgPpwP6\xfQ}Emyq޶M=qփaǥfjUFJycnp5)b) U鞔7F˷;{R/^ Zy[o_j 1bPck!˄e `էCnMۥ}tB۷|MG-68l~~ֱ|[G ׍޾׷~(nܞu?d46Xts֨\z{U[k:L:V$*#CRj_ɷJUmDnq@ 1Ry41PG~(:t3n6ޚ:ËIlSZ;ѻ)F'#=Oh*[8sPa`1[>Nb9 ۯ";\*6T @a֤nZN*tQ#oX) Kokj?N˒̓NZkOZtȫb̧$ďNJЖc4`sF,x9de۸*HLȮ>o@#Lf\~j*L1PxhżĜ3VZo*>WahDHTȮ޼ U&8'i*47ץ*.O#P.?#u=Xhjw)C'3F= +'HywAsm.s`Չ[94&QPTkۻ155ǽWm s3n~ shx3# Ł}C Γc'k{ 0ljͺ&Ko6Ny9r$Gbǖ9Gu7횭%7-qWVXz稣sm:P4UI;{s\[;<8nn==v*0<q\Svc֟lA+vqRA!ڼ|b9vh%*ɷ ګENPV>U;7m9?:P5FE }TH9@1&j۶]ٔy7Y<+#ֈNzVco֨ k2Uꎩ{;Sykʨ3I'V9LKSRC$[ךK3q֧0==*y<"[gPS#ZXnkÖ >5Av@ .>a(z#*VD~ߎ!d b8xѷ~ZZyrUl׭9S~Ub(*AZ"aQ) :n̼꼑7 Jr~"g㚼)?59` Aށܥ$BqQOϻ֛@D?> h^3քnJұUH~JoJzӃ#Rl4^;tE',YQKThi ޞ<D93mO?Ҥa?Ҁ-,LG(\܏z WP篥G48+?Zd,{S_ý:>?Z}?ZeN*ɸPdaRC(.W*-[@UpCGPڬp}(yF 6ϑUlY0ޕ4p(>\/Ǧj R"lrx5 ~g\._bjUu?+Tm9֤D~KlZlJa}y⣚A0 0 ϥO}xF3Q/\gPT YN}#<=0@Yc8<3 pNU~؀"T`|V{1znmҜ-DY0HVq@Ny [#lw Q{MH\1UV %[P;S8P UTfS'@f\Me+TbRռm΀&syY0N)}8D3>&%Yʜt<6󞝾@'w7*-cQ δ1Y+o=IKw~uěs|bO@Kr~6 |V"[9Ҧ`3جuSfVW>.IF԰1?!LxY~f@5hYH^}ϴ}*מrPb?]j:{SQl`wʻ=i4Hby֤?ƳaB5, Ȝ?Z,_[_ AހOzvކ?.:|;& Shy8 {wvg Pџ% T$9IzԖ€ CUg^8ɠ _'<ŨTi?1SGrOր#jTn+7j<ُՏ_@ U{nG!ǽ6M(*y!NyǵW{78'XqSilwoU^͢&[̋qMHbU?~j).~n=0 ^Xh:k6Z-rXشd7> _ CsnfJFޝSV(/0| vJX|5 {?ϙ|PR3c7pM?stz~t}o0B;# $ss66ǀh3+ATbMwZ;ʀ+j)57 _j)0_J^6[?+_E-}xl~ ~|\V=W?>,6w&t 7.՚c?ssfݾIpkWP9]Qؒ#>qTxBPZ4hGSE(R|ޣ+af.FI/ 5w8p=jCSĿ0揳4A7S@/7_OJ"y9gTn( MqPKsjz +~^Vf2bm ֩۴{ZPϵ;$7|f}ܚR29^GA@El\TOC$M p% {SLXMx*;ѺS<8\G2 ȩ3cӚ >*Isr=+'p{4ح?WXu*vOnL!{qB㚰8 ly.qRG.A(VcnsL1^?gc8w n?JtK{ӛ?-@hAeQ\}{ӆ1۟S"%GS%h$MdSjG=(2el'AR7z@1oC)vZzs+lgKx_imf79?.1UO_ZI̼0k })D?v; IJ ґ97 (DyGU>*y7H7JCoěԑ3[U8?8$ ұa:%˓Unth 8Q\2ڪAi$ʮr*biob2m[Pm_JЃ#̗w*SfSqW#PyMTBbN29:U{l}ߝB m@e:۷$eT⤊o0u'sN+(F~n隝= z+i l^L Oې=G*c8)Rrzf =qF "q-cҢEXJw0cF%yiZЊrޞzՄ)Xj??q \tiǩ3Lj[+/j7c:PCFWjU\jb z cA+zPO2X/P#>X3x@7ӡ"qMwj[-3Md:f{SpwrkBX9wڣx7}އڤ v2?‘mYoʔBs\xCcsެB OO :@ZG<ҴRW+ܩ{MUwoj]8qӵ,J& > ޙ}h8V'Uu=S.?׊Op|榃Ċ㏔:V7`=( VZjH%) ۿ5B.3JT)2ާBѷv+&N5wWM)uV{(RCn(N*a/ϭlCmp{SM8Nf8j-Ĺ=ǰ5IJk36蘖cL{U[5;* 2ѿ^Ok8+9bV?U-F볧YI~5{[q隱o} 5&e?UK?_O~4qZ~8iKv֤`1ioΡ}9<_|J,6ǃ2k?^P^=& 7};mʑdL"r6`Uˆ85 (cڑSC~RPi6B{Ґzw` Hɖ (hmȬ?PCm4_95'ZAG?ZthCol-{?JegeNT\bn:SOU2H'87R=MtV?QValndbv> ,m\K;[dz2Զ}(tr:Z_+(GXl棕@ ;Z_w ݸ@X3Nщ)w|ޔד{Fޞ<}M5ajszYLk1ڙo΀Owb Ո֬$*xjǰn+FwsUc@0֤KpʣcӥX&d=}((S$A `w/ZwRJpJ)r1֨hs+dJZBce!s^[exJmK.OJי9Ugn|! .>n9Up;uZ W4Xu_mb3%h\ޗ2VvWңt FskOB|T6?xs)28_ΡXUOBpZrx]s׭AYKr:Qnx3/sADS;̹L#m*l!U~hXNK/XykCۭu+cri^+7 W-h0ajuG=- A^JZ)`2d>f,˻m1c(w#!~ozMLTi=U$!>n8ި xSdnFݥv#?# -wIǠΝ#eV$4me>]WqXoR; /'KMumۿ֯]x-o:KTU =vib*;Fh~;--OFzyoP=64ɝ5+kOJWb=r2s֜'?ٵIa[UnYxrOP1?Nj$b^#qȸEc41\I/y\05ܞ✀7) wfo| f܌ 5V|>VtS>>aUa\F嫖zeG0YPNG^볝_84-Bp.=VœyOfGh\-_7㚱#E~@  8J|ک>xW\{ٰǮy95(Z‡x?{N5 G1&~g==,HG-TqVҬB@Y&XI .9g oT\G=1L:nfv!˟WTc>ԓ:z)U'XXʟ_oJ1'ljFѾ\zo=Br?XSzb,-.^w5g#UK`Gְ. t4I{wު;I-;Sg,QVե:ᛧo(%ߙ<桸dWր;)oҨއ Ŷ#0l2hV ()Nuܟ!8V1ӊmcC}|VƓkLh꣊4l B] lqh*Cm>I+T xa\L4+!sZϠVY.pqUa463:Kb]iwkneVSTo% *Gc2S ֚5S?ZڸS@ H|W9)<6)2!4NUdV^J%_j#W,Қ/YGGhDYXՆƒ[uUaWf=*Ƥ)5 {)sɨަ\}ZTSqoޙt7˵ҽ2[!nrpk¿h-tv6><[C ICa:I۱_)S`9_Bޞ9_Q=ۼZLc$9˩I9VO7}k:\EV#;z%@j,VF摶Ӧ}ڛ_Z@M~T P0${ӶFi˴3/>E$ Χbq3g@_03Fc֬oOdbGnJѫ5u"cw҂Y …,79SdĬrzոZ5M'^~C ޢ0zR27>\)hhcrPMv-E RwZ OKD\p7g@گ([fݟZ[D?w^kn_Nj2YϽZ`{h mw;i}MK@ޔJ:s8d8X1nSSQtۀS:X֡=P:N֑n\* 9Uej}q͟J>lzV* n¨=^Ií\qQ9^hTqޔ49@2wڏPZ!@6O_z͚w4X C'Y[-dt$ǭ?8Y/}jvʃ=PpN1V;=8Sq9jFA~n?@(7q֡sM72}? cȤ~UIZ,@s}rCL&vѷq<@ MrGCS^WҫM.})[t5dn sOAUH$n ɫPthhn}h)+qQ5έ<!3UqsMw [wjRp|3ր!o}J(>~iӏ] NEMx!㯥XlbMߕHmH+M"l릞_QDϓAf5195yc*P=OztAS@QyQ;VMdw$n Z K)+DR2ȴ(`giO>QVtdB;SJL"P~oơysޣ7\=*9dNh֚aPgmvƪJmaj}~J g@ o5n-&ӊlU :P݌8<(* o_^}zU 6:b`?{ qJb"hIݷ7z[߮*T4H.O5,z|ɝ۱oZǴڦkh^Z eX^f#y(8qTuWH[K㝵1E^Sֆ{4c|j08P=Xhس?SmH'2&[c|\e$pû?t?zb?oFg^Z9_*+BS)^N:g4zx{K\Tl}9u|\\mD6W$~cY_ڢ2yIzsՈIѸk" hyDmn;KGo1&otogkM~$}#9QC9GyZ|3.ߠqӊ<8SHkx; w*zi.ZWڡw6[TlXq!77Vx^15E'-F+KnÁ֪]xn(hD)\rGZ4ϣqSB g8n- Ѷ8ܞacaY|d28Hߍj^7#n=lMֻ t152ҴE#iri;Yj҇JU*[=1ִ! )ˍ/cs!Hzf"wytJJG\ ׃Q#;WXݷm϶(۟qQqLrO*Y-GEV#r]vpv 1uy`[+^?Vo_zԼsajG.'#lf?|@ح[HEeIvXw֬Os3" "O?nXUh zz9hausvs]RQ5GE+c />Y9y 7]JB8f鎕O{:U_7J9X̿2I9՛y%_kbqh>qҝ\˅3ϧ5 BrGz膏}NMH*XLs})XS\t:tWF(aaw&𫐝÷hSקJHW1Z,ۏS銑4 M}άÕzJEA߭[M=O& K(ZfX{SZ]o]A֨3ޗ0ry[r(GZh{F>n\qflwxwEh};MR(ܵB6Օ`u3ZÚ+ə|ةS NZaYS\ ܿ.i`i~zsE؏[q[# YNv[o֔\waU̕4^8U'XZ+vkA{Rr`JK>h5X|M)ォALJ϶c(ֲ~%Gc^omN;8o 8ž oIL׋!/ֳwcvk:X|Z7c?Q+|uGęڸ^ǭSgёi1֫^\5#Rî0@/[qK({ɦo劢 BaJpNUN٠Zt_{ґ:!h$f52ǔݍ@2@ĺ˟`iFįJ~U ֝ ǚ::Y}*FT\GQ*9${ jr皇R On5@߹?y=($+eڿ\WW Q|܃@4RHT~jXF{m#]Ƭ:l F%vՏh/UV6+[cɫPD#kY+sLČ N(E 8U/'u$i$̠܎sS EsQjEZoJٖXOS5RW*ܞN]O#߷\qGOe5$+–+̫ө~cocҡiʜPޟ)mU"U?KSkF}YU6`ﴚ;3>bsLKMuNn2h*3}μPb6?ZtV nҦlZy9x-H7D$21k>7,`zԎ\7LGMUsO[o3@̣sTaaXzU;Dr7F e{qUոs(#ցC(nܑCޛK#㿽RbL~]>y\iz0 IOFxZAx7fߗKtOOz$QhG қ^- CqڣW8|"ѷyO uC<*ǎܚbI B9Usb+ 6:tUWzs&4Rz⦎ukGd[Ud;c5<0Oi>lmk[Tz} 5Ս;LII7=M:k%qDf#hGp!gݜz&evCzN)0{凫c9ꁷP:h!ܮ׏yby;iWn}Mlp9n!y短HgX 25lҦMCBL~TBLUYN*ػ}iۖq}dg=Y1`gWP=>J08jYn~(#Hi,g+^|樥z W#,tQv܍ܒjI_JsCIb}sO>MִI@+1PK'}3K<[*VS (޴Ѯ4v= wH-[B ML*I}jkm 5ma8=EAoj̣Zz}ߛZ[yCW-NxA 4g֔H8#q0ddDZVx*I,7sT-bU 9ϘX֫i\zjбJ9m+>SrZ'k'RCnmCMJG_rDh'oNMsEsƛ፛?I-|}i~aIdr{U-|>OU [[%TcҚ'miV6(-o^KeQ5= ##GfQ9M4^~FmJqV ˏ^5 ۃ#+h!p]n4`dJZ>è?JؒHf>І9W,ՍCJdjv U2+p3\??Ty[v˽Xb5 -ݎmX닅ݺgHQq,c_.gZϾ>OUBIUGA֫V#.Vuo}HִiSm5s!~5c[~_AZ0cnDNE;m%iiִ;ݨe^D^T)l*^fҡfnKPݞHX:aҺÐ o֪^m<C)3ڻ{MJKh U#&<۴ⷬejyP9o*kOa7(ӕWDRw}ľVC  )ccۭiEFI=*w0~\c/ҬCdzY!c?H6? :ojPVHc?y~ƹE@,,6#j_57Uj t}bT}B57Ƌ7,oWJD>W>VzT J^J͹ВEou5}c1/Cvc_x+(FvsJ+MUXUbp;TbDFjzۗ}\HIWvª;Pp#QKi.}*|(x1}Fj8,㎘&O֬+ ~^99Ki!=~FNw06}Pi#۽jx1~u_3hc)|1U;89U#ԑ.89Krt/^Τ48ڗ(sIn{qz\QwֽzmUQ)׎|vmHULROï)Up|PyUya^QSvϽ}M".|s=wl`|DSgQiSTCmLI+wu?ʠ=歸wf4LJP3o}~atmjNhtB[o>5\@0vM寚K*P8 ƙ uWzJJקjZ骘# [M$oֶ!FZ(2/UjҺ&G?/FҤstp8sUfr=M9vZ sNkpwthԎdjQ;m@Wȧdn;WQR>ڀtݍ>Ku9Da>#=s'35z#{V[ln={PAT[n^ey n}o҂ː6b;T grE /-`oG\XQ*LWָuu'?w 0sS U%)jܨcP e!~ǻ:ڣ_jeě V+ُ֤zbvT3u)2zoL, ~|֧tqO׽Xji~*銿\#U2Qkz}iϟ֦F9? w -c֏dGZ*nTK@#6{j^yQ)jZ pޕHCzw*׷zϺqԗԧ 'vP|G9LvMn QgpLϷFeJ(; ȉ\W]g ׾\qR& =kU>ZAcmHT@msҴ1״PԀ>RlnYҀTB=j6mzTnmf0Ud9t|~ $w$?՗TEn^}O3wzVoaƛ((ePdsQ =;f>t4 ҰJ*؅HaHP;4B!5l4_9,s=To?qc?犫>4]@8V!bݷ"y?ʥ>8@4 j?¯.cvzAvIhY1O J{ނUȍq =ӌ U' _*nx1nVp4zIp>W{Oʈ 7~*z4'LdcU-րnOqUyv7S.i?Ϊ|%;;T|?Yi,ϨV @ųIѾ/ NxfC@?.:yǿh0}ߚk,1-x8-m[$SŽzd+Z8;fD64JxQr}PE4p_çjsCƘʾdǎ5jf,|?ZxˏY0f ?1 v{Gk5̤UYB{TO/S[?塮mwa;O>VkYA{pH14A, SdU)֯crxX-X1$UU&=)]cҠ|n>jOHߺ{W&s޴դ>SM4t5N4D<+}~@_W'3=Z`{lu4yn1jк/GEuQٱ<}j/u%_\aaݚ;-~XgIwUt=PӶ}hbvDLzTFF=}Q B;{ٳ>!s@6rS|Ý>.Uy}j9?9HOB7oʣU٘|ޔ N3}Y'F@94ic9 w dUk!CM|BϷ=⣞! zPI+g~qrG7nP]y}όӖ_IG=&FX@ᓌt!YO{,Crx+˾7pYܮ??TD?v9>M_+/)Ū!y#A_")Xe;W#q*vFNp+xJrDvgBc8'_1cַ֊@gyl~4$%V=ҏ''0r 2Gnj8FjHq.~Q1Ñnjg4v.l݋nᓎSj̻{DmsP0sGJԁ_-^*J6¤J۞惨Fۊcрk^XqPǬ#wLJ6w}zI`}=jT>՟_9o /۟nTRH[plr=Eߴyzֽi>ݬm:ĩ]ŏnePx|ڬ}Ҫ9%z@y6S_-6>S~Jxڡbӧ򨮵/ӊĽid-hW?/JlzaڲIi>ld槶f@vwhFG?Zqo,d6oYW9fZO9@'%+?[Yw`|N};endnE\GZpfb>^ܬy4Zk&*yA{>oYOM>X>s@"I{ o+0֕lԟڤ "|߅$yq}}*?m$*'I'4Bs~jYZ-Yߵl=j _ks3WP1ڴ"ܫtU9{f51P|v$$v:;x犅SToekv5/qRK޳]1u6>a%Syl5:Z,dı+/ϜUgD^΂}E\=kJ=T'/\Ҵ+Pjmf1KU׶taBj}S#E (U?.m{34fk:IN8ʱS#T@.s֡:Xҗ0X]2JV~frjp,$ރߵ ضmSt#B ~@YԈC2yjߗ֑? sK:iyG9+s5kkf'ߞjaGqК `vZ[7P"WzԎ*_jNy [𨍪>DITpP 40gwQHS4ۇ==Fʴ Ȋ=1$n㧭5?7@/$P?ww_჎{P+H)L|RʅwAWI82Ax>eWfN 9zЊj6£zw'V~^N#mh M͞MӯZ C9)LրBiAq4q{Ԃq~C/8秭FV$IjAzB|Α9ǸD}̹/Ң#) qR-2+99#o͎Z~bL.WPc沟aGzǸhZMǠZ#?^Ի1/S7zqUwߊBIO|Y ({Too ORD#83X^ Xr秵O0c^Rrm߅c J#ԙZ|i;mҸ< "`p*9u~くNf8auA֞隍p_9jOp.%Kx(6+qt h(FK2׏J,jMv"\u8B*H깋lv [$zѠIyj9oUXztX43dSp4[sRFWD@QYrzP1qPCzsO.ϧV#bTIEfr99SK==jFKn~\{Hj#>(a.&sڍ*3ADHWVL3zw۱(@QǎYXpy{Oހ\Қ`l #Jq46<#2)Vxj'E{m퓣t ~]kJtgS cPgt4^gQU'A8u4r[d|*5u}(H>n~i0:f#e8j,ymx{J^ kxɩ"QolqQK݇j?6ΠQf9 =rNzTa譟Ҁ+?szT4}>a$oq@i]s5t+qZ:k)7ջUq=jۙ8Ҁ$'>?JjPlNi ho v?6q鏭C jYUcaC܈ZT?{M,OZKvjθѷ^ʎ^}09-N);4zNz JިS9l8%p+4AR v?z{6lUD*/%XjϗoǷs@-[+ֆ@^Zv̏h43Η۳1P 0jst#jZPGHz}ZϺyR j]_ݟ֪&;jŅ2 uhͻ秽Y?HUv*چd78:f>X;D̩,l銉޿ʴeڃU6v 2OM#ߵ\~}h 3/ʼiSS:UEE0)lu ry ޞb?í<[~QR.Sp(d9G$\5u+j`cu,>Q& [>$f]ց/J[A-ǖvUl u\7Sw-$iU[gW[Fu\޻sP<`Ux/< uDX Av\F!e7p}MGZr>әT8ڪֺ`1Zx^]g-T)'Ԛ{ yl4nPF;(jP'j9<~Gu[o{Pab\t?NVp~^WQ늒21[~%O0:lt^EDʹw{ bhcbhyRzs@wX؊"fW5q2nʾW4ܦ|\_wҔ)vXyƍin,n7cpz$.-!Ӯ1l9Pk߈W;jQQޭ|S~bzbc>&mGrq`NE3Mw֥+>P+Gà@lTy/Y#x)_Yc֤[6Ӟ搏0a:s\1;=I, #G@Xr=sQyܿwސ`h!t_^Zkisuk=)ont͓aڙ&[~5Nc``uP;:k+al~ m?Iqj94\ʠךr,Xϥn^YBTJϹzT]Ú5s [UE}-;X HǯRK|܆=eAdL+#>Z9Ut `oE$AVVboըm>sG943߻QŒ]{P oEn:S^Am犮n!G^(I#W9+Qϐ1xUg?s@\hO˃w>Oᚣ fҲcHgOA$?xҷ9=Sl;R{#CZ:Z=S*dT1 su*林ǟƣyr d|ǮE*+(i _3`Z*433oڗUk=]?*/$c˧4l7SXGuۂ9szN&}=֣Eb>kvBi\pwzԋ.*9:HWTR߭6m?juR{P;Mφ6ܼmLJӵwWPnQ8]iۏ8.qKbMw6q[WN74+zjҵ(f& ^$[mL ct60>U! * b^6+`'ߑW_ßj grJlVtxk@ϸ;qQPm%?.!?!}şlTNK7 +)LK1Jcv;hۏ18 'gJ{YG9DJ5ө>I R 4i}7قTTk2׋t'@OԦPOi-MkvUZ/= sB4N3NX3xS%a/V\J› nq1##Pf?({RD|TTc;F#EV#P?Z>SLԡC4Ye6ZɷV+:g @ϭZ󜎔<OL9P)`uJ ϭjdj F'u5 ۙwpN۵m-J"{ҤfN^N4r,Q֫Q@ԿcڧE\ciU g4X /QpcǩZuVuצ(`U8mV"7~ 0-RD llpBdjö3S$g=?Z-[1xۥCTj%i1=jO~n:zbid/*cs֯ \͏K{SGj-=j&ܦ$UL}*Sdd³- v+Hth#իywj=ż;͏AW[.[˷v92M20irЯ+ʛ{}{T\=jeyu n#;P6}7|:9ҚnwMB;8 u(,=*(Ӝ08d8k)yLS_7UyCwZ>Fb;{qRQ>Xml)l(ӥU5`D>@}=(Oʣm=>*I~tc/lR|}ܿ4zP QV-X1Yn zfR+3QUO8*hkzQqA'|Ґ1=ic>n˜Ipի[=*nSL(X&|p*r*l>D͜q@_jq>8&bJ|fA)y__m#i3_Zk}J4u:TS"qP\Pv߅Hf?ҩ&hGPIl}jEݏQ2Kzp('|/z w=*iܣ9t8?*_/DF2D,@y GJ03C[nh؉~z,3}ޕp}9g:PXkSA\sڮ7'PVN>u?JcۜzThݪ)o8jdC`=(1m>ljeV~U|@aUOޣ11펣4!MBc|p0HĹT0(L:4mLdlJr>v+1ϥ|sXQNkU'7wc~^䊯]`Jb9QTU [t)P:q]>spq\Yeۜȭ-Q̣j;HO<ԒTt=x ݔ4z 06>_8K@ez/H?LdT2ȭ.7sI%}?{1Y>S=nvk_,uG+t=jA>E*}U&cA] >\92DR?ǭ$ s> Grv!9G+[^4 0qT72wp*oGoVFp}8̎/"e'+A O?z\|קVCANQWT0\cn9^*rH *ж)ǐ1V?NsTKd[ }bB?4w"S`%:j'gfKQr#G F?ӥL~n޴)>$sozIxCnN3O-3V\DpSwcpϽ\MS*nV<ի[ڃ2s3ⅤfYHvIOW GP lz\~M^|DUpp\WXnNKe#&-گNw%ɧ2`c*6[P֭fj#u$v^<ǥT@ǡ47S<[z/4~@·Jc :S[n2&bDW3}ja S<^zԦ,!4?y*\c֕fظݷ@.=*Vhzf8L@4qk3s-nlӢV{)^*v9>jww<~|ʁ FP#lzqS!JS@ʱ?w沯.qZR3.4Ww ͟jo]Km/uk}sր!BFxi?c$U?T5K s?Ts0XF\ߚLIS^BS/$pu 7p} TŰrY>hi.ZyzwӞ*ImVŽ΀)۳O*$qR\/OʡmAUU gq4 npj6 V Jomڞ@"Gj)9,PSojZTR<;{TwakLt2ygLi˞Wޜ^}8 #Ƈ2+?TrYIŷ]xh==J\j֤K1긫`8YF^)cȩ O h|Ոjm#*A6nXf-׭[Hzf6VԆɭk1Ӡ9ڝ(x$YUS} 3Os֚~M+Za6Ah{ސŌ}{ )$g4Č.K|ޕ*sKF͵;?m,P\ q hrcUnd_>R|RhQ/3}***.Ɂr*T-$=!*rmЖz^^{`w!Tx=*IV$PŹ:@G#h`U/Ҳuq@I}M[\^♭atM85<ڎǡGsˎ!B6>{;đ.Uҥb}guPɬ,=0;E&N GsW/?AUlz`[c=Ja\@L7s$5wqnƎarXṦ>;Ÿ_NN㵿Z|ñ՛+owl OoӸ/Kr>ar=:¸7񼒜uOpSÊz]!+ެG qs 붜)^O5xIe]S_k.W\մ:w89YtI'f˪{iQwnnʯԫ*7MɿV6ϙMOCAK9NJ~\+o' ֤׼ 0r4ުw}GQRI*hgw*BU>ŏwJ%P:.Q-QUY.U<iRGRQ^l⢻Ԕ/ U$rKtZU1oLJѮ~f6K|G3[YwmQJ݊ hݻؚW`mK{Þ MnǶjQLRH ('+²仒<jޥ" 8sxcv2^;}EfNO9K!9悑jR1TgnL;RZڻy)sBVlܑV }*G ؎1 *{nǥё@ϽZ:c=jаqSH8w.=jaB}jb[$ȫ gbJ*WD6M=k7Rlk^}\XgwB^[7֦|'\/~eL#{rVnME\E =zԃX\p)xYmo%H>/'U =5rrӼԑ޼ɕ~nɫU1DO)b2Y}8ˌWŵtjo&AzeA/Ҭ!PFb˖ WX9OPYcQZiE^^_?ťޣ^}7sZ|9Y p } M!c}=mfYB.1z9r{Ph &J$cj'~o9Y_Z>d2z=zK~#93vcS1wI'A+5\1ҹ!\\YMW&]ij^)Mӧ4ĊS qb.&[{~a{&?{Y ޖG 07 y&A v\{#,`U;ZhY{{PޠzLnsk+Gzԉ]H]OJ9FrQP1kkdS[I%9$P,ľfݬus2i4!oCS[itMqS6}{<:|dnv=XQyyr=3U.4%Q۟ƪˡL@1kN3RG?*ȶ`@Vzb7u8BY8r?bU#v>w3Eߡ@:Ug~f^d1!I~qu6mNiA{|V(n񨥁oNp:ח`זᙾbɮ#emymAu8&Kk}|}2v#핥t#?ZhZfq3Ͱ Ǩ5ШiVKb޵pcTm;*sGq >TE\?Θk8P 4eO͟S0g?z  p>ҤܧaֈwY&7+sR~* 4qVcZ6zEL,|$"4m Zn=@=(C@Qq89S=*5-~u]yaz8'֙vqϥY( 8=(VcTn[Fg'v3ZBGͺ[s{i#cd6⮉,y#m d?^W(w%M\ӗHtϵo}c{vսiX.ce`.={Lv6t2[9LR5E]n@iDa:BB;l0 MZl;SφMl;;pV#51=f[i㷧Js˕d }9fDIzxw~X5YxU!r pR,dOa}CzP2[dQ֡W1ҁ\{r75Q[* T[6 sׯ(]yvg֠l@<(*(pwtUwŴf#$rqIuJLphxx3MZ4~aHoz̺` T Xۯ|bnne[k}#O7=qJtݩ۽9[pdڻ7~mg+qz`]Fm#H/C(^:U RrcJ-ZmGug?z[tS\o~1Ŀ\Iy~^Xm*~nj[{OTs*p7N? Ԭ^^k3mNKmnO1ලQr*՟)mwmi_ʬ8!~μzTR}F;/==6Hz/i$ss+ި &WmvX69Ptt<͑=1VT𪰹z(+"m_]*"w݊\®:9Գ&#qWO%Oz(>RI+)WaD SrקX=WMKIa#k0C@aӎ(~8^r߆}*9/eU4A$q֦G*~OÒ;4W`WYoߘ{tIm]J9X\売&޵lٔ͑ gmnۗF(05yzTOkuZ>=JV ҷ7EV۔|rnqnz:PRxkUWV#]C^ǃ5U<9P|iAW´;9Lu+ڋ ȟNS¯zk.ss}n3J a~UVI>ҺAtߊVå7Uw䞕=ֺȬ$g:v EXӵN:k],s㧧ҭ[{M 0Mۊ[0W={p$kFޝ8R2543Sd9Me>yn S˼/7SYw^pl([6.ORcGjK^n>OleуU xڦQ+UfGYnlsG?9|~eƤx?!3926z⽸x&'t1 ^̮c܃>W׳ Gp}ȩBt}ُ6%NFN]!|׻G.ݯ> _ ɏ-*= Wm&objnep[|W FJnj(E?fǗx>xE}\FyZ?ujUհJ=s#no,iS#+..Td㴽Ap(c ֥$sz{x{| ͂S㎔(|T:0ZK٥8jٷw@EiA\¨9Wl\ҥ[rz,B/aȩ.hcd+V,К:UYm$iϱu\k&UaLMVG7:Ɨ-qYz^skV+U_}h v%[ }FSH5$+OcsUjD 9Ua.AoV"'ס@?wRZU񟗑WUۑbgPͷ-^f3R,aw*NWi'6 %SyU fg/V+Zw~a=M/֯&>Q"X)W]>.p*΍c)1Pk"]>{Wrڗ(Ԏ<,ўT}i[@11~wSS犬31+:#;jsZCfn|>x`1~vjm.6Vڴ4zVtO~Arh>j妓qT?ԋȣ_J4f`CIss|A4ojMw"s5*)HF奣J0*徘Wϥ !#w=@ 8V"dZ iZb~QjonJ~@X(GLz+mz#7ޤXۊ¸Vrۆs4CN[sQ߼=h6~HP4 Z[mf687|ǥaˠM_PN lzsulnJ|4ۺu+=7r(1ξ# ښ*;cmW{G@sJRw-WUBj='@Dx%ҕ)8kMF;ℵ9w96/᯳v_eIJ{ LzP3kmګS Jh 9080߇ZG^vzUʓõ*nGWg^GBYT?TI*3M⧔tvT0?Zdž/v6ELU}7z7_7TTg(ޜ#(FItYr*UPNק֐ R7zzLy{OI?րcqV!zg8=~*B/[~{n;"uYrz:AORM94pp:{O4M.ޤ-ZkJ^ @8$;x5p)J*E {7JL^g{ň:P9ǵsDm7ަ6THӽ3͖2Xk*#zs:JӰިJ>C[j$lT/Ҁoc´ G!TV|,{fmE?]-ϯJZvAT;uOv= 5$^IsPgP.=+WKp#7}%34NdsJl''5z5 c7.dRd{(Jke\3F{MN[?,P<UTB# d1 硧5_ާ E5287SVĬT[?w<09?#?q޺5;Ve~"s,wN0{ZxleEHF|D9Vuql\F\|a"HHһ 7 #GMKBxD%#݅cN9]g$Rσϭ0,0o\U%XjJ3}A&7~o)e=YQʤ q,NP/i$x7y{ҳ[{ը5ۂ0}h$|Q T[S]zwKz$r8~]6?{>`4U'QUboҲKSa,ޝ ž>ʮ}qҭLyo\PW)4Ý*jOjO]GSsQgV7)SM5bqۧҀI zoqZG5@SNX>Ρ8SMR"ǵHAQVONUgۗ{Φ ^BMKqjwzqLmD8<Ѡ-b~UiWGȩ h4W=>_ƮH^\}@j.35#o14*6P*h63=.Bza]Q,:tv7"9-;&?Jm݌W㵍"1=3uxОucFbtvpx4fQٛzXpgu]CzqWm>I1!wTsQ];~Z>iه1H4!vɣ0fqc(py+GPuQS4-UޟV=Kk/VMWE֨iצk+lIw ӚAt7\5oP o=1R7)vV,Z?5a/r5ZQ }*BA4\zaOlsޜu җ0hڡeQsQqH*̒tRil##ݔTQqI|~h_Eͽjq549˫MoU^]] ޝddl6LM=~/ZԂs˓@%`)?Jc5COvbiX\~T ٨^1M9I ݣ'!}@ZPc҂GCөN} {tKTgڦH]!HsR.+X{u% vsQwv})(ꄞ= W1ƎA.mzjnbBjJVm#ޫˠFӧZю})`#G9yqYx%AخYel7OJC8qb[tD:NIO 6a"P=wgϥ\)$w*m.=s^>Yu$4X\1YMnEkGn@qi@\Y 4hy^ kU⦆O1C`sc&.qT^/E0kUU4l8~Tc1}M{ M ^7nϽñ5ߎ+FWUs~W peMK<:qg֞#}l£鞹PJqJɁ .$V Xti4k Trr2B֬ "8͎ۧ5֨<;Uq&{sG)#[KG*?N _Mb2ݹ>ҋ f3h9򧮇򌏭hO{ dgSFw/:siX Qmdŕ}LH̽ ER9?ʒ[%>ƽ)Q sABH3<V#/?Js>`쬖*=*qޘnT} Y!Oaמi j&~R2i|zf FRqRG ozPR(9Y|B#4IRZSaM ŏ"7?¼td359*h"9UcLs׵U-Kzz/-ߓR4S f̟{sZ:6҂50_sS+/֪YWNW1 с,y\eOje)`\_jhScځb碞 Zep 9P#gb+jGjEhW8T90iXNP:j95M}sV]lU |F@G4lvHRyP+I0@nsҤMluTnPGNi矺HZ[\8od!Je|ăWGO]9PPI =sO־}&i+oѷ򯠵8(^ܚ!ν_w9^U&0{Q)$aQ}jzlx`==*ln0 j3ޫ5UJ>aP`G1"$v|Z"0T|ySPrs*vV'=>7G_Z( #U 2=q֜$UPOZ٬ :zUk=g޹ѵKi+Hh؍aRJf6j-[3ҚX7OM[=G;O9֣e$.ӥ7ϯJzRtO͞~jV ǯ"i>[$.q*@L)Dqh稪7n>pqҠ*s S⤀y͆jv,c&`oϭVL g Hu҇X|V{\j/ Ҁ/OrERFy?Jz@dp>eLyRGڤD(~n*uBjo[ޕ%\e]N v1yb2ml(!Niw/u"GlPCjMoOjY~VRؒpzRL ~5l?*wNR (9B 0vبƋ}{֤2"ŻcXAh{TꞙfdZ0Si+D\E҈43M#c{ԂU_p#~^EA 3:u .;j#t@=) 8O^:ADb"=tǺbhq1Q`FvJTMwΓ6.#^/cQ}XqZuZ&qnRj C.suQcއ7muUIݳN$M,m{sֺ2mk҆׊4ȷ Ւ^y2o$aᾔjLu4}h1<|N)!pÞy#@3`y-zUU֜zL%Ծi#cJ#*׿L,L0gj^=1j6qfjčqڐ\loaڛ>c )U$rѿ~lt`!Mёc֤YNp:rp)"_=Z#q4[n9S44?ҭYYdv9®;?_ƟBn㊙cۧ+ErK6HShziXL'BH쵝b+]D8Z0R!cR6]\t uMq z ~"Ʌ +i{$e~TrN}*jGR |dS_7[8"?gڙm?f"w)r`s2G!GUŎ]Ve}}VbOӥK*%QyJkU$+zT1=}h7-(oiQ[OZt"`S,~7p{SL{($U7Vw{YPU4$Œ5VU)&ϭn寶gR%QHrÚl1ݱwnw C㊪[=PQ/r>5 ,ígBj;VgJ/5$3yM:x%Y*rjcWCwUoUKN)/toen*oq1SQn nJқAglTE0~%nsMKVTsnh zxq1׹R*7OL2лg3_ϿM~^Bր#K1uR'_F-<Hb%cg_JXUn[4ƍe4e/玽isScZBr̻ONkJԚ$#Z7ެ,2†P@D=uzf ԑΪqIF:}j&O_W>oӭVܮ8V.*x;v_DoURyJjڒhr8WzP2țp>UXv}?#S`}8,\Gz1.Xzt{P"H*ʤr߷netDs\K))#·8?i@!}DJҏ2PK|YD|.OlCvgI`Ӛ˂Rϧj.&جO#M0C%:㏖Hndj}i9T ((v;haU?yOh0UMBEJ?}j@ vJiz=*@ uV%POC?OIg U6qS6zA@XmqMxO u0v'Ny⮖ZMR5QܙGCTvܩ?S^/ />Ƌ+zzn˚jgOk mW|%sޞ8[҂=jVU(QwF{~i\tw|j>_QB3Сw/4>Xv |5/^;UUK*皞7#43*6v=["p~O8ڜqM2m>Xia& zbv7׋}Jr@hlaҧg)ێ¨YDҟojZĨǹd :PG6?vRwjarԩ!s4b?PU!}5av?*qi&1ӊnDć} =Ӿ1LpY0۞)¤,vS# ;V<~S5V;S?@ E:S0z}xP7?1~q@yOR9*^沌(䗭z櫴Gm;c\lT?FJ}I/0x.ҽʴgoj̆s)oZsnm?yFUJ1Iu0M^#޲LI@7`iKM+UcL7_M`w֋4Z[ڲbI4& -<* [}*Q25 Yo "V?R|y恡k6fI$P2ݣCj6SmM8.ҭ쎠n["2MN+~E}+nZ #1n2%F0yPHOzh8l~";*󎿕8d*mJ@ۚ9ޔDvyU"wLs*fD[<Ҁ%WpjJ1r?>@aˢ9+cgv>щU v ڸھ—oQ4rWǟwR4 ֡D2:dÜaj",:/j/Ƿ;웏s3c8xW>͑ϵIl!W?J ܎ /*aS71iu!6ک]E}+Eܿ5^Xp}gjq!4`߼dcqRG:gH m+P@L[԰Gߚ`I>nDցWv uD{T%ǽIn<᫒@Ò=yYO9q߁K'>=iL:18 8MA}:+i%8>jG(ۜu5.@Vv+\Qf>_(O3^9?=b>PΊU?Noop0s(szTr:8c8SA<4ݛ{qa@ cu(ޕFr :fS*oF=j[Uj4 PM1[6>zz ,o5JhWo@w2n_ޫFD5,w*rԒ1P6}*HT$azVcx.yyS^ x-q@'ӎԄH}jEB)b*N*,26jn.{ s'E0ͱ~)fl)@)IΫV7levMMhIқ38 ^~FLc۷]U-*z[)9Nk/1G^j'%[#DG_S^=5avօ{@..J_֖IvԪU{gGC6NE_69dޛ,*Z hQ%88LoGsA%׸=c9>oZ|L0ӥYX檪;vzYF^Ivv}(f_UBI~yz%wP |6Zf[Op*Q##>#=)I-^ݨG"y2~fKb@Áڧv"TqvM?-*j_>%V#i0@^_N:չH\t5Zd1۞簩c!}}3ڧq@ xc?Wx6ǭM!7C/9[(܊F6(X|Z!6z'@XM75Q zץ5Wo;ր4(z6?QL߾jxPmEqQ!z{ˮ2: PUҤ=>W5Pc}#HҨOo|ˌ R1x Z;$,FȬTwe5JTj 1RlR(ٟ81ǿ~`|˃@oؐ?C]nl!a\v\4bրh, /J*sVAۏZ(QcZvf[|)4%1cWdQUgy^(O;ѳ "Ԇ=^cB|6((ztaϥnm{UKE-> RSV$z:+8.*4e- aN2n^ *h$#>Gܜq]$WYҁi1ZdN6=jݶm*iS l _I4#`#A%67sMrC{/Oz#Nqzits?;b_JnЇ#u%Ҥ^Ffxɫ*V sgn?)wOZvm *~l_ƭe|zT(d6WS,d}=3oϥHwN5"[3S@G͌}}*V~RcqK"UztcŢztP[P+J>t+Nqpiځ)22*AmfFs*XԞQ`+b"GU7< >o@0P06g S"L 99?UfHk/8.X̽j{1R e>TZϽSyquW[~KҀHb0ήrF}*8@_Ӕ<ނ r ݪl"tsNQW}(%?l~UZ{,qsPMw8=w${BSbi2}EF,bxɮ}1SQu/ ; mL /l⧶w*bqPHҥȽr)/wZ}"t݌QZr2RInxUk26OL (nqfǩejplb 4UiHb~ Œlv7T.*)Kb1ƑҬCG9|RNIҫ=jPku_LF6U#_4Z7^NžU.U~Ҥ&^yoR3M-r, vT *(Z !G+V6Z I|j]꫷W"i?;z{V:'ո)ٓa2hZ٪ >zr^O0Pt)J}>fJ4DCq?i_0M'z'op>D!2j;V)TJI\ǻ]5Sem?0d%Nħsq=q@Bc=8㚝q"OLHWd?1>!-E9c:aS`NU;T\*nTbcX;z-۳PW" dj8ڴ8 TrE?x 9_yTsx}WZ:mTƨ6zRwb=p=E9FqڠoNzfgjsCG]6k{UϽ{ Z>iG*h=BCf'AӚ;UPN]JVҹf[c@9⺋?Oι> iwRTm+.i9S_?P/eK1|E|mWlcZ:IK|cw_Un |˸{V}ƪێ՛u{ƠP}YWN͆`3]>u.BۃVysW Gޠn|HF;qSn*ٍXzkVQ93naީ$˚#goT]Z&5x&+ȹ]}3`EJ /V@p{0(U}@P9H'ӣRp*ܐNh/XpxɃ]+C .>(0;zԑ>`zȊӞ «Udz2|/*+rwQ 28[4DOC֤wV7 @Z1MZ0hQMpڼ8<y֤ m]UP8orzV{:iEiި͈u6[gz~Qv÷Ӛˏơ19G=ʹ\@vHW &Xpr?Zvk2{S+֢ 3yng=jwWf#?-H*U$hgPTK&rwUan~f LcҫC󓷩L0f#3T }ZTڪ[& ;N/JM7k8\/lU  GDj}?Z#A(Lq֓rZ+U.~oIp?ʟҠp?{-E͏N:;1&?nD>ˍLDvPh,,ɶAųSU' ȑ~Tbg2p^~oZdGbqK >;ʔJKNjd 9(qJn֩gՋho];hO.qӁR[:*$epO%cNosD.̮sM߽Uǥ9~oJ# RYR}i9G"3j5>HA`~0sҀ`7cR\c$Pvh?rtf8( RA.{})C5VI@5֬EfV5Lw ?bý1ɇv// U^֦{C]Q 3I(۾SޫMJ rȌphF ZH-4P l6*HZ/^UV^1T%QޣM7,i5rKvfUf9$w"3OႽ\_) ߔ^ 6ڣn/0P?y?ZIn~L(tNI/j9\[fǠ\>(|ίG\{sEÔиOAʳN٧&m7k/ iXGu$WXf_g_gq=9y/Uv Ұ`ԋ;;Wl~=E:8wx.ayazAPJ?) }(tF`-6xZoN-E[\uq =ifZE3:ː{nM+]*Nh[aO1o\ꡣWu~zʫG͚|q{&c]qn3s67z ??ॺi FpcY/WNQi+C]uYvЎF+Khrv\RV\Tn,YFU9,Q~MEU)/x֫Is~=ԷlsCBYEtprWPِcӜ&Jυwߡ =ǥ)lLޕ3\ޑ#-7cgnXkAQBS nW#e'4?~%TԊ7Fsi3$_w[*%h"B)J|}Qm h.ߡE,1(NvS3@$ }X䟥 6WlQ"*?~?F줜B'=qSEot zq|qTLq5IP2MI.ӽ+;bxsӧWM@|0J-ٱާN2x8d15;|i^*~Nq@oԂ]52n~ 2(` ܴ}OJ`vThuVZCҀ+vԟh`#̡^=i$=ڢ3Tf>#U=EX!/|; }\WOjt5S\5z~Ug*ņn})7:UCs~Vu\nIFd5)ms0\5N]G?zV&$Iy/ozvQң1PVW7Җ}N;z {:ިMWcSԼWhn{R ^**wnKְ!̱jZ|с{؟Q;~_lx+`r;Vw\V>T@v kIw֔Qy #A׊҄}ڪ YbXަ #Fӯ<+;|qTK'GGn|7gmHݎ}3A&֣'r*XĝzVLyBrG҇ajIHH%[様e?)5b=EyXc n Z0X\*v+ɍnFب{ZvҍEb *fa{%.uVaT%س*֘3`=sQ) +J1ۭMd}Cjom?wzC+'S S֏ߛaeS|UYBSZPYX~5{7/ZSnWߊ5 IQF0<.8&ùV65'c_ҋ1kzw.{*mIgpUur/$ӶJ kzCM1Xpgb?iZ&Y&FXKocOׁN4rw1Te+V~Z\I}+)- 6z3;12H횩:H$[8P[hB!^n0H,*n{;#b橙A/C](;x dr-jnft>d gAE>Y7?uVm5mT׺> @u2D.THd4߈o^]CZH#[}0ڭӐ Q;i&??oΩmz%ilG߹Şi>ͤ+EWZL7lV7($:]r?­[\O}6_/Z:5/^ þ4և mJ}z[7I 2CPBZ:>(5R*fyk[;*/^RPKd8w83Vu} 貫7ߵVxDVq-Ro-KK*0, Y7'-GYմS7xI}Ǟ"D/ "T*3NIϔi5@>VMDe@g*y,ПwW79%G.R▟cct{=ѐ:5ygW~߷+oK^9^jxwe`+Ӯl|Om喥[̳Ap}u$0"{ ($zN¹ȧY{Tb7;O&ݷnJ*zs֕fF}jlYzkէrsS̚I6sKtkœԟql5s;5kosH4/CcIg\]Zn^ip͍#s 8 uI*UhTU(-.2օ=S宖 .2[X0zRy(7GԿآ!W= oJHsz|amNܽbK5Ҫj4"4gn* #haڳ'mosސŝ~Hݕy=egdBosM09Oz6;PB>[}/nzisvL?ɪ^ze犊B>րڒ<@1sɦ8?§jwiSXJџppjTܑ+F֢Smiֱf-vM-W*ȵso/v01'Tg3JT3貰o5Ѥ% ӳV~Wjշ8?M˴8kJ+7x\5Qz' | YYKF:EBw&ǝGPexޤx#=[ڀ#hFϗZk[3˚Lq Ib۰F}b[+})C>X eI(ZUTask`Ocֶ;PУ)En,\wQUa`]˷D4t`F {Ub_SQe&x2F# $U#9Ton=Î5-e JķqIm)B?7 ZVp~zmhjܰ(+iD/aZyN,ԯE9G]l*wr}bTg@Z-\jn>_zArRiN2)5OTG*Z2ހv}Kbcc=4}wÌӢԳoC%߂JIހv]Oi~w =*U |=Gdt@Y~θ䞙j]3.V;CB a2UsLN@[EQq$qlsqpǖ[G̠o4SEfOC*z$ʧꭴUoȣUG(ѮҢN/U=3]UŸfjEI-֣V=bLfVڽ~@wvhkLs2sZZsƫ t kZ`GBCz|4sT^2+ZsR[X4mԏls4{OAޠݟx=`j2 Xy񎾵ͥoץWo|(#6yв157g'BeK :wni*ϯsn{7=jި g@C5}j[{~n!s&yQGp:uru~6ݠhrDj++E9f# VU91r_xwqB֢V7@fK~ϓVrLs>ܸE w56c3-57=3ӭq?n4ycI^޼㾃*4Y'es }NVvQV9mOPk٦fb=o*߹5򌤣մNx"/dd-H ^ nOި|Ҟlt2Fqހ:GCzN@N~Ni eϽi `*2&3+ONlZR ۯuZKp5K2cTebU;k2&=DG-6jսz,kV })j O R]#W38֌vҜ4d,u5< xuQ2:j&(xҲ`})FG˷FOU0tr{eЎgjٖ@BhY=h(;3f(=j`V }㡧vK4ب=iyU.?>:9ZD$ld.9SMLcԚ h|ڑmWwi|O 0{ВT1Pl }qZ ޡdׯ$ڀ(w͹NոPϧ'zskeӾҤck{ִUwU?^<3#ҫIpx[-T2WiX w.vӣg*6}<7`ާDXҐcF9V`7coZ ګHWsMtׅG_h>[^x^^݂}j-o~T4Hh=ZTPڡ猎6ncVN!8=ګ*cTfoN!ߛz{C \*vw31 ,8ך%dPV?6}>~ % ҬBz]%}޹se1E_:'n}@;ULIގPiPvzZӷZ$]ù=*x~TT'{zR%H~l bSZϵ7R?W9m[*;NT- vsw+Wm% y[E.+} g _m8=1R5l{UMD.pmFO׊H3*!W~\SB9v4-s[I=@gb\¸8+RkUʪӃJaڂ^PN=rM? G1H z[ia{xۚ3*8={Uî=F@w.ݥ~(1|*uAOv3ݘۏaޣ6lԳU>7Q";vDD} &rƊǑrKX.42Q^#Ozx,y~BOKբ'I/uA#;]axu40p <tS;×z-冧='R3/eA[t88gq \|e[Wh~:w6}tݤqWZ?[L,Ҧ1GM%rJI\y8ep03+xrH;zF Q<~EX&R=M 2TaOZ`{_>2:'H<Ƹ T1cu?k=^x:l6zJ4V򭱋?vr fLD/U?7[=K.`N\"QX?uO.#XE<1 ;ō-"#s<شs]}=B$QsEuCAdsֹD|-mIkƷk{-+nR(0(gڠ Yni>,|AKCj[HrTP6^#Ǩ|aG]Qɧ<~ixl{e-hs];6r@5^Khtק$բ-4?u)HmŽ1xA/ǚZ]]۽~OZ68~DP&Ec/X'$4״x\sZ<7<x μ1xFkc/g^]k3/i>.&3ۅFO⫯kzu އ2OoK$K lY +260wv-\o4>0<1w{+֐6TڡB>~#^ZخO ɨYDq4qp[Y2<=Jq|nOI&{[;$'fbܒk8wn|f|FiaT\_F1;p R)yeo[7i:E5o#n>Aa{+QMk֡i]hKY࿚Wؙ_Q+_ | ],] ]7aox9ᘜg^|)>l棢[m@1HHojh\=O< rMoꚕ6\hڡ,%bNK:HI9y6麋P4ݏ;[h+q_^=uTֿf]w:zﻺjx}$a @~ _uob}cI|tmqfߵwr0R@'84]}O_ c@,|9]Hɩ*d|* V 8k'IzVyTM?:`k>m!g˸s$9p-^t{_5fsxG¾!-^ <;ci$X:;bc5+?r,?k?Iokխ|A un|=W:[I7YhƅZj-C#:0x5+{|Is{?k-J 3H : -jzwoÿxw->6]xMRifJkEcګ\-pP0"3N=Y<y+{S^W ~//xz^׵x.8;_lONWUsw ̫x1c&0~Q(32Io%~EubBvS^$~qlYvc߽Ut2"Q?NKEe:P[#s:;5^*wvքTcӽP&Uk|lT[ qo^)EoAYSR{O0+|;Zprp7v4(˺]=c}ߗֺ1nqsMX94J_nՙ$[=*@AFxusd}@qhԗJ>$do4>$SI͌¡1<*k)uT'ʑM%( rxAop$[TJVVjX_Z,k`Zе҆?Mooj;Ug+ڭ&=@W u!M8HtO[Po!O;Urst~TѥvZ 4ׁS jpo)`Z`3@ gJV)aw)f",=zUY#G Jp=jن}8FG+$-Qd:ֈ\p&"Vk)Cy{9,9-;9X″|ՄLV /LTJćJ9@ȚObūuV֝VP9s354zlCEI iQݜ*OCץn})#CwXZ3Ԓ$j%r C,Xa=x֡x~*yX9q'F'VsQ,_5+:&M6`b;H >'ֆ+qM[ w{d# åɧ|ErV-_*liBX+eRzTR;*T,= gj ӊ| מ+kG$Ack"^:cR8EMm;~\xkrqR+rk[ams銘 } AHL/#+GL"?Z괛}*Jsh%2M2ձiK{J4,7oZiYӾzk]N'Gs70⣗ZhD[C)s򌎔|A^js}z[93KA,*Ud\ե,Wwqn0~@d]I9T'T3m>< g(>_B%G54^ T˷vzc5o4|*K=hE_5B*yǭ 'ߎ{Udvy;Xg"K9S᝱$rjfW@t85i6K6_ϭYNd|r>nfC`bz|TQOoJ,wF܊kCcޜ2L f^)7/sUc}R>_^#꫃ӭ66R⢕>}*̿(;z@#;$QXQj~O\VXn\*Hf|[7tV+|HX9ӊnhvi<~jhwnh 2? p6MW28MdAnO|f8>l$U8ҞPuer6*9ooZxjߦMfdź-3E[8MVӝ53bΦ~֔z~3S@\pR--[۷׎ŸqzE~_ƙ$QӮ%31!}y;囜Tp;،?P#ց*:ka84"1[L^Im_t7:RYzBk0*(3k ^=8p} ށ̲y\T2T.P.fV5F*I隵$ڭw@;Tֺ;Iz-P?t W#+@4t:%[,y}jg*^(MMהʽsT88l ߏւI`W~U;櫬;O*EHr{I`u02nH aEj_'g<ہYܬs@DOҫKns3Gw`Y]KxJQGj*Q x,TSYysjB[#`o5n6=*{Vo?Z1twힴ(ٜ}Wި1weϷ5afly>cnqM}*&6 Hο0{B84-S2x}QK-8⣕ )?w;X= uEݝidc)݁35Y^k EThÞh_|Wůs?f$]i]k(%5bT .͊4M[K/"%]N5iac o#M$ #H~&|>=oY:-X8uy#nh,0 ܵhc O4oo"PHA Λy`=^!V~.$7VÖKvixΔHz(w,Al*^h?Iy-I[uTL)?XM qI2Giz;Q_h  x*[{^<)gu]~Gl r^FamǀUm.?4wjRH23۸q岀O e;=|Eȍj14BoQXG&'+x&Ic-6tت~"Dgc rNAdwC4/ڮ`UnsA Tz@r-rekDf!?,yWʇc5f!tЫܙLDK# ~y\tO~^50l L\ [w9mckYVf'!r yyE?#$W5sX] wzL07my=׾*ׅckaHtYu;ktV+YV7q~A#>!~#.n\_'QUee-XoNۍG] C>/5m'M[Im 0dU0qm$0_WAc2Ny5:t2Qc<3c};{r𽭜rKp.Ś}b+{ɼw81i,!1&Oab;X(ڪ}͖wq/QO>2]JNٿ[P78KW8x}OKʒ.;VBN}{o鿳[kO:-avJTyzZ+Id>d$~iYrp@7.Z_<]#^ֶ,zeq@ *#,("_k}^'1 }gS[>\BlY'a"?Gxz Q vpnaʂAH.4w?"[zm?R:rׯdn*no -hE,~IoK$TH4V/߃y(l|eKx҆2.E>U3Oʹ5xVicfAo#[iinv~ZB-rj\B0}Z)n-uTe{`,n\䏜 A'ojnےi:8UVERB 8߆#*>0Wg_##v2q6r<ž_YZ%֫iBOhW6]n%Lv9o=ZJh5um^,nRw,HҜy|zޯ]x> 7:o iSĻCх&ok_ lM[IẐI&kw;/#瘀si_{4-|="xgo7,K#M7[Xa U]FG#_~(5ohkk쌭s[Jlp#8 c dq^Qx`>$j/ٴ[3I1,+4N'h dq|3愛a}5X' mn0"O/9m46%]ڿǟEo?x\.u+9,,Հ!<׍47 ccCAx㮣miz|@ozjiŃ-"ʖ%'ߞ|üƼ^1Nu&o-5EZ)EuzMxfo :N\yjh֗F&kxDv9%] '$d$D2|)9NxLꚇt۟iE-I!wR9val ~|:]?ZX4f6C_\C%XrGq__h͎KWܷQxڔM%N2Wtʼn!61Qck6~)oZoď>gi3$jꬭxFsZ~0|xOͼ]C>YuVj{6tڅ+bВyjNGJ{8[S\9Vx^9R*|o}/n ubOi KNUIiD&HsaFRfi]i:k'8dhf~~Yp68`?4S?Fu-sǭC&Xsڱ~$v+3zsUs7Lv{TsMtXf8Fv櫛l iUN4;XP4/QSs@fXpiE>Uj@BrjbwNCJ'Sրd҆ I3g[2=cW+ }>nPÏGhTuLmknGUnjڹUaj qöN*9V?vfׄ*Z4n+J-7#v~j~Oz 1fVzf P>SҴ ^뷵5nǢ+2{ՈtuEsxQOQkS L_,*8^YnT5`#|_ϭ=_c;T+$#jv;FGN  Ʒۯ!G'קZ7lSH.zu\4 Mkm9YPRe?Ê'JBʮ8Fy=J}MF[a9Dk5(;DrܪPO2z,c3ҳn 4o~cYQߞO~S:~hMǿ 2oZnggXbdOKPVUWpzSgaƲocuj hb(?2u;>HQj%?NaTHMsNcHmLFYWtb= R6/5v$ƾݫ.=QOh)-ƿ-/]AWo($b5ycҿWv_tkL ~OHHqV%2 ɏj~\*gqT 3ѿ#2y99Dz.Vl_ǎH&zPW+7"OJv;\]w zkxa[ZKzt"ND]ѫ{WY|kќP=p+[;(tVdү U;3%vJ krJTG(ӭu/1Ӛ42"e0@:~U7 {ՈO娳V3ZvH`\OK(7"\@ц랟A@jڸt;V H`mӧnRt 󿖸Qu>\ IVXU[?#Oδ!vYɷFjtLEL}بE'T]G֤[րԑ`pߗ:6~5JcU?#Mh3 H/PVPG槏b՜oמih2iF{VzY׵X[~B%GPsҮ$Srj$T[uy21ՃQ(+LS5+bI:SZ5=K&$tChJ4O]*Q xPMy:z Vmǧ8/yQ^:cC .S{I#sZ[n~YT v\v5fϿ*ƾR${V GY2_,d\k怱 ?Y+g֦MMe>޴i"_I?ZG󦶠ڂVƮHӜo\3A]C$Swai¯@$=U3܉ˑU)3ܶ8ݚ1\I-CR5+zC(ۦ=1ޜaު0?늎[GyݔӸM"㚫4jQ=sQOrvz*0:9hzyEӥQe?J s!2a&Ag=cۑAD6~8r%~֥& ?$}(%4Iϯ#\̣] +ٳV!̐uiczBp.}h#R8:t=*ahcSY-FL3a8sLѕ; ;sǥ4?~j '-EنM gLвIN=FnNw>4 Vx$\y@>}i`oB[a(ֈ [ fvՈbuf 0ȧJ߽Pk YWB z"ŕ㧦ia_1n;O4K$(8%R$@U sM#Y/950)jjs#^rizbQlԱꀱaD*[7 Ջ}ҸPO@#* XxĽBZܴ#d}[;#'-RKU+sv19FNFihqm]C$bK򣢚Wgx>CsgoqJgQ1 ׈$9"r-S⇍:_6J84_ # Z mF hrskO?:~b?W4+o%ho"ǖ 0 ᖧx7\{K=GEMR6̐)X$JZ51eM9ߵNGdּxmIp^=w HcBN .^Oz/Eִ&v,&.ϙ4/%L{PTu=o>y%.@qqDnܘ(V 3K6 q1& { ~qp38_4Oº+xu! ZNܨWhx;Ѓ߽WO)o>[[]I@𨵘|臗,D@9W|/TЛxu 7H >g6NHۜ.霊%&}6)5it_i1,A7۾7B )>aMJS4QH;$wd` IPO*RscN^ml[m 5 6>\<8G7OT}WB{ |O䱒3k}˺)$X+&H3K/cqHk}f!խMJ,mq.7uB.^6܇Y_-(?{k)8*zI5tiNٜ ֣h-XH3 FHWDv ו-*@1E?R$z}l_%,I: `|x沷4]Bt0 yy;x£T1V*4Z%ӯ%n6Y6]7/>$Hu!j2*MHbGeWд15^\ZjQ0~nX&ͩim*NlK bpKg+]a:hVVͧk#8HYHy8 9ђ#ᓣꚧu+zTi3_YH~;|1kΥ~1h$Oi8m.>&JShUI6}٬|UGlw r,jĐFz S,I5<742s#,!# ;-|$όt[/DxjV{b佉J"H!<ѝu^/-|]x*KAgM A"x&L`rwVV{iZ~ğ4 XyYslb6;+fWcY?g.}qiڳ9Hody>`%6Y$ \Exb:|-[}S0h7$FVQka?i_ oů.14[Zh{[i#xe~dG!a.O{{@>xTi{:σGtb ߽"pCGqc%#أ5/ZWڃ$zַJs0J@Sڧ-l^PV#ZͶm s27Br#5["y[~iZ~|n~"1s}Ro{[deF2qYXvdO!2 G?O?ٟ½P?%|0 lLX_iQ6y&Â#8f~#m?A{Yݬ>nܼ(C.|;⌵*Q(4}b\W?Zo}"[=o"kYݵ&q9I#XU#hg$eVzR3*xhX?7=9c*eF[d+(jQ9J)8Gfݩvfnhv|SH'Qt1BV9y5Q>_Yeo~U.^)CYpns֭[N(=JˑYkmw5{nO2lHE:U?+6z/L^j)9C$Sv:i3皐&`_@ՅEusNx_~4P[=&ϥ$l>jWsm2(nsǵDSw?0>/(k1׎j`> >ySyx~41@%sNK>Zf8|ɠh^a?JpaGnM"`3jUf^l1F{Q'x0aNjz]K;h1zޣ0l.xȫc)pO@YlSaVO~7j/n *{NCaҢqp(]UR q 98 SBMgxS=y84 JUV{a2s tdlT֗}jŴ/@Zy'E"94#}*'q}s@Mg <͘_ԦThނj oQL"5,`~]*7J߮ 'vkW$K^>Qp0#Ҥ2Ԏ @!EVqG,Sp֧b`UBnwqiloP3q@  g%x5$vL(FUqfGzP?LՈCO$Vyk~ĞZU0@MmK}㚆6$yƭߵ3N &o'0}(Q~qֈVsjE+PMLG` Mq<}((Ko1n=Mr_l6O9Y@ %oPGZ?,{³>_x~@ȡd<O\ӣg7GnW~NHȦ]ZBqϯ,F3n\Vh2F*JLN+{zSX?NED>`sF2ts9eoֶdos`p hۇBk[vߗae\4YwwHj Ȭ97*"ex T\g=+1/1Cⰻ,X~#N~_f8nǥ*H[׭abd To 1#4;ޚ|=>eҢ9 QOXzV.&j^+}gW<돕OL㝹(ozlÞӣPؑCƤ}:c&Ct?ҳsӭ,2x uRx᪺Sqƀ&FۚUIgڠDInTǮ:Pm^R֐\}i\hVcҚe=WgRźǁڀ. ϗoݏ^߅6 (nR;SϭL_Jڑ>,vRlP(%]48-5zMxUNZ[IwqE1UٙץK1Vn鸌:ӱnD@lS ;~46su$ٜ8?63K匟Rfr#ޫүjd^FHM I1,~vv|mX 70ʁ\DBlg>rF?J8]ߕ8_1D=6 @ҜxnUTYb~^:[1*>F?ң+ڧ@JVP:cUҖ+whfb fȢS0wM1U9%zw°|]FW}j@nhBzV6qJd'<VD$R]mi-҂r29w*$ȫzPQb)zm *h# ۺvhyk&/ɮCEڳaxutyhD7unNTҤ,zEN> Tn=*FLoji1#ށ܀ۺRF֥LIYzc4nK䲎HJɍ^;$O^*N>Sɠ 2{mX} MuU$;OZ;S ~89*m IUFT4&nfL׏[HD)Nj?0sM_18-@ߺvUlSQ6i~e.o8]_֩}F(ē9"?M. k@l0\2|QP\ּ>.rw77q9 Ge/!MCS)IO,Gdד'| kmyPO .>sNLp1,+9K[F:\4k֋z|I ]qAFH\d-> p'qiZ޹I5M;#ˎܲ.6Fґ+2<|wm{R7^Ԣ*m[L^(tX*5CG}[~ ic[ڒF-Tec!mbvo 8)u:#wEƏʡ~}7\$08AUݟ)|M!mho m-aw09_xoP[nY-beݓ6s7 xЫ\X3ψ4=[X5fe%4FO#/Z_tz:՝ΏggF;bOCͿD o{Y$cRtf_1FN$P/7irLJld˼lsa`w]1{22?N;خkkʍ 88qȝu K-rfW#mtV @7m onj? icQi2L%$<6OμW~+񽏆^m*%]BY6Eq5[V;Q:ى?(17yG ?'80sY{kdC-֪K\-îk<$*AmX@JӼh|ro2.֑z0,zy4^Ei,ci <ܸ(88$]fӶh-qIxRvT暏쿢y.< K(NA'5wįѴ#[syK`j3#1ȯ5}GzƷs $2|fy\h j8mԴ; ɞ,mh3Xx5KV+_O]Bh.mhַ)̖Wv7'~0G-?cZڿ73xfYde dK]̉G-ßw<ڕ/oZ5srraϡ|=/fohzC/xm|LEIc|"2~e9\u<|Fڣ[΍w-Ǝީ%y2($(' m?.vZ7;ڕu' jlkR37]9> iK=;Ymyˣӕm,Dduo_1mYq SKylF)-~챰*zF*|q?x?дy|7;_|~еKoV8g LYRX2F} }ݩۆ̲ )o SW)'T]>;jHW)[ny5M#j M{o*+&!2?_J (Hۃ&fQ ;=?:v=< Cq@$ wbI[v"Jx>\׭0 qZ];SNUI_S)|]JU'jk֞F[''*j rE5"xy#ߧaY:Trz;U?ڦum͜S–ZkrhBbgy43'1NeQpV}nXK9eŸj ~5)felP!rb9U {⦝gm==aj{ǒ8GWՈ_@#X )h٘k}Zve]Z>sTd5Ȳ=G5gN_<*EyqNb.3 9#hd'"#&#'T*<@Ƞi/M ?PW|ZHfV8>Nh1/R.3HJژ߼׵>Bx┨֣Hq}sRF|L J|)Sڦ~˘'1h#nrǔݖda"&dҁ۱k\΁n=={"})]gցj1%M-~6? b#1@KJݏ֤3yGi"+SVoX $8jC&ǵ~۱~nH >i*PC&ݗNkFt=5^}@~N\GOj K{ta:f挰#5y%[{ue?.9\ϋ"T<`{S_ښN{+&3u7ߚ/sVqv>FlZ;',~&fʥ}8|w^;2Eft 鷟0G*ٱn*7#@lX?XMXמи鎹EzTcy+ߧZd_/ր:HSڻM ϩ/BM v'*bMbҵfU+ 0Tz֪HG5ED8^ˌR2/S8\đqVrb2Hw|Ph1N֢ك}jPۆ1^bSǭ?;0aϥr:ջ{^rzK[uY": |^ڼ=jO*Ck@8h$Nu3c;+*[%ej R4e}j KҦ[WQa%EFZ)U84s͞Ȍ9alo'}l[҂Ft}Ú*wQ#x.K¢CZ2~1J Q&z/W~՜֧?)V4!3.cD#^of]_(]a@Cq `uLy'F[g]d9$f| {k_ 4a-`ڲ;nZ98 .y"RX+.O(~%aƶZs(pQ ĒH*mO\x[=7Jmj( x;]#xOxt Oij9*8!eP8ڹ8lZ\xWMռ9BXĀB}ٳkjivZW|uMCW/smķ'Ԍ<þ8Ab+bP]/K<$Fnlm1KM.AOi __G7tr"f#"grH'צ|&/چ k>%·Öx# cbU6E-ῄϦk ̆Xu/+X%ܱ>Z2qz-3’2ΡkU\m;esӚHo[1< mc\6J֗gʙɷF+bx=s\i{8YaSn=1{s[u=ґƚ6GcEWJnGق0&6ݤ{eݲdu3N>u+zݟ5$!vwsW[S:dv-IqiOc>zHR <,E;O*XpsYy1Լ*k^]vm%L+*޽Ewy}i4K*3I%4ɴ}>[H qּZ[ivmcľdUdm`o|Mz8zɣwO^ak?ǫ\Qj^BǪ:їUA`@>ރó6ƭm3hPF^kUTE"ne(C/<9x^Ҿ$AW b䕂8+x~-/\SZAuYA{x9uUD#+n@"JZO]5_ imSoim"VTŽҲEN!\{7?xB¿۞-, Wt]))R |0ռ;ٶ_Ow[|bVy%JGex\GACV;h? :1=l"$]c(7fcUyjZVOִ@~Amۓop ҁDй &cOΡS~1t}ѝVo‡ c7qܢD8f񕤚Ɨ{i5g[^K%%e$2$=lj_o/}7^)Y~2i$*YՂTV ܍LLumC{2V2 gimk{]N ΍1Ŕt_T[I<%|sk鿴atׂ=;:ЅP#Ql 4@5 kZOuxf4{^Y57(洛x*+lo-Ыv_<'+so5ޔZD|ž\ye $dV5$YY$0$G2 =OzZ7-d@j&8% t鏯$-yTI#7we=UTzM;qgt2ΧV+Ub3W+MkҀԑ~ ?Z^>Gi?ީ"'W iaqמo_ΥK{{s,_+ s(_aTa(phካ)W_΁I~\+'?J@IV-Ӡ⁲I"sߵ@[~~J5\&?#4/&qp{Qsvz7)FELǏOTP7n3UgZ/7ﶕN(♙Z?|s*N>Z -ÏI`#sLvf9ҧsQ[@a~j0X?ٶO֣~@ Fc5;Gc<#Szv+):wlm8)hyrܳ6ҿWI5qv9ԟ.*aǧ*I@W=:}k;8#?Oߛ'߭W{.3$e}3ֳ&%"]=.Kmj8r?XY((x;OSOywxŰ;wƑy8 "]yH 臨Q\ h?Q@~9拉`Pߒ?Jī>ǭ>h9j\gE ?J-nLWqype{<Ȝ\mb+e^q>E64Z±VGx#ךfXǠ($m{wl!G5ox[t$ֽ ixy{Nq^Ǯ]H>Eqڿ6;1mXZ؃6@T7G[zKDP 5"L:S>}=h\SVaW0an]*.9݁PAoZ6`Qn{<2ƻWZvֺ}*ܰ]0D vPZTqO[u5p|UjAigް6)IW#uG$y*'L.@.NX$.T\O~Qވb9Te2_ҟ+,Nr*32RHA?Zkasz;,jS~mvycG 5 f1WѴaj#NFGoƀs1gc>zzuT.q6g| )MzPnьIsToӬ=G_Zw 35> V]:h—3pk(A⤎Hx9iemXPjnka\8j\N3O #!O=rКʻe*Fzuv5;vͽ~j'#AQq>vz6U[1OAZcб}9XWhTǗG*\JȨzv,hU Dyy@x㞦ǃ*k*V]6Oӽ{T~T+xW 2yMh:N {SU<@Z/1pݽn֬I*Lز JefRH츦4y :զpێ)G^j 2nDaN泑]$cM-`cYBc۹Nu?-2KoJ@6Iw7QQIUybvד>jd~S6zs4ͬz<iH<;EU#5Σ4xqSb|PReؗ;xR5yUC"dop*F^@ޛ6 1}h_ﳐ~wzm2~#Z-<[{`O7'8\] #wY7{fYΦgõs>r+.:.5F'iR{ڂץ@}*'`3(A.vP(un>qޤ7!+t6Ú 1v ?C%ۥ`lZ\)0ݻAݳ\>ޫj﷖M07zdT1Iu'*~fKx>?ZQu4lsڹBySuW`vK}7zەpkXqϭ9n׊.>ۜnu22zKo7-ǥL쌝EOiw:W,">l V۹'>`7i91ư+>=^6OONiϪm0'mppZgwCTյ }?OeF(e 9xZ ƥ}3-*48TANĀ5Ɵsq6^gUi- 6:np`y SjJCY{&/`ݍ 8|LnItQf[]ONS-̷ZӾAHس^KUm?s:?ڬa[A7ybYVw|գị @\;x,GxrE-Կpqft34_Z0nu+gk)o ViA<:::ek/ >T*LVh5ho͞$v F&"I W|~=[VЗBkav;->y G NΛ5cZtNǤj﮴&kF[$Q"LQc_՞mM 7mj).n6!PQU)xLZ6u=>+D_3 H!}!,g6g9[vHaB79S/\墻gu:|ϖ&'Chq-טPt,i9[Gn'SVO=I8f6f;G˳gy&m1R3)Թ𱎬IcI1Hm[4PD!Tz NYwz!K417dUWtp OVz'K:'Y[y0ۣ< i9#_9Ho$c5x,lw8ox {>Rܲڟw5Ӯ4!k嶨JehY#\HlzeLGx(&s|>UI#\Y>k3~TѓwiI"Xʑ ,!ՁbAiMD 1a9IAɓ4enjVLӖ,`;~n˓KS]mO <';Z7r;뚡iqm"$rL] nd?ju{gDPF_~&gue ZE 2?JОk~)j=oRldo21".נ}k⏊vs mmڏ 9I :/9\m}2+d8<]N㟔gy7iPkyq8ɷ%4EN{֌">3%ŭ#y_~ڟt{V@nD%H,ШbS~|Lҿh贿]{VH&* dfYW%Uϗo*kO^xcJm-.F(ڌ!kd`P4m*& ׊n5 {-7ZcqEg8*mOmʉ+LC1 ==K1X~Wc~*/45 \^iw VS<+i`R7Fnq\k 㜚Ni'i:>Ooylb?.5V 01zc=k-X- >i^-mSi:ţBrTLÂ'e&u+&R4[WפFk&J&IP¨%ٜ[X\ mmu]/Q٦ܼNؤHbr+vͿ-yׇ5kRœ$m/nlak[R%ZVMDzq[hbv{w1coƑt]-ʦqNNE1*6oӚrQ|_QYA^ ܸ 5sjȬϽU8 ד@+G#ۖSۛUT0GAADȨ^A1SQylǟE_8|{s oCSۢYR~tl q=Mt̼:Ž]ڂR>8攲dW)&ўS 3yN*7?ΓYQ?ZUGvL9nbp+JG$ȣuQ2ا5ʧD_ZI|} K8RCgO9_J,U㼱(1jq⟓Ŏs~л}*9\xIjwt`;%7ҁkn`6č;ǭzdzriB+mbˍ=G^1.S`~8QB/N㯮ixx8bpNh+;&P?dQ oO֎are#׭Msw\]v<ޯX G08CȻ={f5ͧ#-ըaNm?*qrN}iFɫBU٦m"2ܓOvj21R`PϵZGeA{A#YV&3ֳDqN?/O:IԖ^FZ\IMYemZXB>jdovisnS ^ qPjʻQk/eQ¹߻}i!V0 u4 a}68u ~)=WfW.<|i,~Sn.ձްCIfJWku(zbCzV{jpXT7s'F=y.`7 Ոu1&yumҨkdƕƫ;eb zzջ`wE+6YEz^54L*ήB7j6C}jxn1k%&aǡ'ۻmlcNPj~o֧CŸȬMA|yjݒFҫ/gv`cZvhFYOzX?*Lߚ:~( (?6pzո5)ݝqg&vazOp5[ \ǎ؎p,dž,`- 3ҨkXRhgmY@گ oP3H1Tr7ץer@棊o+ۮ{fC}{UX9&h\4 UUo]*FI} X3)o^|̧;Sюi|szc@Ȟo=:U;ܬr=+BFy&~h-O@`9 <ǎEVoX-q Eqw>OTdFoʪȎ t"1 l"ʒM #:@L\y3t9vs^ Y8ox )?:85$s=~^]%[je)kJ9r=R xiv3۵wHn* 1dӱfX4mvPAʧֽ/ =C!l6/.͚׷㞵?y !ixq2?za⵭-qڪ $lvi'6ql/PMx}ꀮ K}mhq@ }Aknɪ ?J}ʀ4G)_1=hV*s~#ު5Iң^7 l sTe.ޫͅ~w7NrG+(O+"\+K HOYVt'8#֦f*qL ?;㊊K}EWj0GJ`[3jE{u׸fzXn7E 4wCjWR,Ut'֡1;ɐ'fK:)UQUKJ+5rmEnǩ,xU w>|)1=Hs@\xAJϖJm8sQ4 G&>c%#m犗=epR+hٷtYFx(qUǮ) [wzh&~Z_g c)tih2cV%d989<3T2>7zWV#׶M=Ewc_ d2xpNl9n:R03|r1bd$ToZnk:wcҕ92;[,Pǡc]shqW-Q_/.4Z𭎜F;~[֧?eS\ <E,Q.u[ '?9njioxKӣG4K,,Ff\|>;_ψz_ ;h5}FqᐴӺ<W'Ť-0>e׉n/HY(P3bq֦Hi|Mjkgw{k+!N{C`@tk~gcuc=͸_Mګ层$lx5xg|6mjǦ&Gbr} pnGS$́Wk,_ )mzB2y-\jZk )%ȯz:x>Xդat4ǚ'/n 17vϊ?t[SVV7ѭn_ >%?,W{xjMf]iPDmaIyebY>TvE᩾-M'_/4Ythc8Pcޑ4Q&౟5pA!JV;MdOٛL+=&t ?]T^]vecXDb\P9e|)D𦝣۬,6v+ HU@y~Pwns PGkv,} OyC,b9~bGLΤчYĒ4#1Z" o.3BB32ܜ=jty6j+It?SZq&WlL(8֪݃Ɩ~lwo1;1 sc^$U8#(ϩIe< u ne#ev Fo֣X >Q;Sn]Xd(%}*AkB!Vs8kX,R1dzYI\uk3I ኲfQ؞._CwjV͚hQH.y^+RO @HlW72$mbT7m|zW#gh897ŹwmeNzA\1I wdK3Ě42hwȿ+"*x9ڼ:MIV3aغ~icG ?>s4KY晤#qb[N1?3H=yY4a;;ho!ٰ;BH$?AkStB8t -V#-n%pXNm!?$*>o|0CLkն>R2)!@$j[ ?l/?RSY6wfY991OUg>>s2hW XC}k.jP,WPjs`$G ~&u݆{e߉4xKNH ѵm[u: kWo/~Q83]mfZ5[=f7a~#UB\cKpL!wr~f~!x^:{]B\OG7 G'9+[-Zm#ÖGt{4Ύl*2 )Qт?|],~|/oy3j8n \G%S3F9 ѵA{wAmf1/h0r*F]?F=y>nfߊ+ J_ _)yD9Xb'޽O ǘQhcy;1mWAG?qTе:h>USaqCKYK~*1n+W-p{S3֎VK6RF w=ME$1_zAY9tپ9;%N})jGv7!t.392OnM]{] f²g#g^*yC\1r|zf:9@ 늼IqT'#az БӮj4{G?^?5`q#Pʈ?5=@9㞵X|XzUޥΪƕE ̬֧|>p=dhSI'/E)?Z[G5i>h]|7"ҹwEF{%=OqZje]{դȊQ[eow6TLۯj,1zT2kju~U?Naz@bɪ)!۽Ign3Uk\x_OfAê} W+-]Oj3bճ|Mo AsC{r9!#}}ꌺCJzpJauɡ*{rqG+w:%6ڧzj4Xї?mE"SE [h2 (_sV$?{ʻ/R&F=T#ø^r-]@^My Og11m3Zڒ)90wW#֬l0I<ޜi W' IWv*,4 #GOniي:/&0R;ڛ9}h$.sMNiJq KPqٛ-t7|SVM^WHif|MM-jSQGWooOn~u:R49]rCmZCf\gڻMnX7#y+7$[ƪF /|8kinh&r{S9s w0_\{K}9VA-űy4oqH61ڷܜg iaX_5X¹,9zEt6,2$uf4YA₏2V7xNpUxzN!]˹rx٠V`~\ޑ5f# I~iSGmܯ( vW[s}:jvzzVH$S{$PH95@o>#5@ujJ{?J#Y6=ȫI> ex+WKdTDžK{SH dYˊ|ק4uc]RO5Ǚ [9&Um׽ LjO&SEf[T1րp݉[orAU[9';u,Z vXֳN7GPMI'}j޼W>(:zPQZ挨bSA9= cI$W]ޕWX>b=Mg]!UI4/ˤ.̜ai#=}FIzQ}ց\>Si*9֤h5NrOaRyh{bo5&{ɟ cgJ:)֣Nzu`/Qp3SJ\j+ǥ*BӭV+隿f)STYråL`|SoVEoƂ\4|*snlkQ9j9lՇO€ɶ4,ߗ=t/~Ч>@smUӅyZSCoZcq@)9n;zs[e37b5oTei֤cZ V,mܽ:-`Ҵ,gְSRM/5a"*z=qVLL$=v;u^MI7VQꋌRfUosL}ӏFto)2-7oZ^imW]Jc>hR~}jIݟ\y̻PUgZ͹a@yqM2,jrN=<}x E6+/NEuֻ H, -M6j/1~UpC mSB7} Y^Qk@-\-7}^FgӜUqیPؽBǣuj7sUٗ¤Tl~* ;b:S8lcz@rAjV>+]jcoJ%X_4a "} ?V>ZYsJj2BuWmOZnJPXߎ* :ϽL+b* V~mV#e֧k=m6㯥,k\^{P,pG e`Wf6 x]{b<7^j ogq=\yh55PR\$6?߽9oGM?g&}oQ˖ռQH|iq q.!n6E}6 70jy.=m -8ؐu"gj !nYXމ? 2\^\0[0G>T\nnxtWf_Dg[aGvɩy$şkN@!q׈Fo|akfgqtB T 1|0# )x+^*RC,6͂rsqjIF?kwφ7b9Ⱥ;n8׃#Ԥ6T#%Rڙ;3H.<β._9#?3U]3WQyf8棛QoYqG_^KSĩqe@zSxb?,+G <Oe|4bGӽG3YsB 9/pX٘/˸՗ɕz`TRFCq`YW!E?C{LlY?)yilVW /+z=HϽ>||Wvv}N71vs8 lU5N+`ZO.S` -ѤC.sN¶!;nP-*&Xq}yϥgZ٤p:>>RGT5s>=ڗx!V閯#&I2 ٢Mk', <5e[;b?- v1n:}'Kn{e8 wgP֬5WPNff6ٔKI(T6ק^7}Y,|e67jP[kOP:SjVjYZKiܲn2ErHA"fHQ+~>X.4}]>9Z<$j+egNQO/7}ZRk5)Ym"ncB.EUTx9j2M1R.qcT$|A%Sm=F=5JyomW0<\B9k˾?'4*=BRMBtL>YaC& F.jZ_{kCZ}O7'Fbm0&U@$3^-)%[SO/-n$Wb|zO|E뚟[/n 77 Pw8fC452)Ŵ3p оrJܠTc#"3$ӭSֿ4hn+!+$y\pc|cDvݭ5,F-H|Rx϶|*t|,ZOPsK{c΂Pdy(d9ſخttadقP&ەGIl/`>e_.-jLbz8$%w{W>1:6isj)UAvx0|2_X'AuA=SOh2Tӳ"qOT{)N|ثObA })g}2k{sY/UV;s-Wj)Tt>VX tC8itz|^K&JWfN0p)v֩Ns ;Ӟi Q:Փi\S%!{}(WQPsU9Pq~F[pQb>ƮEo [4{ *3i]Ƿ;zuY7 d襺I)G(F3OHW#֦M pi^gSjcƊoZ3 ~h'CU`*I+sQ+vOU繏=3z[V۟Sm-_C% ?6y^u~`ΞE*㊹tZT \&ONEG֠BI*).xl8O֬<_)7UoNG֨Ί}y)O);W4&>=4#KgUeRxǷh3o靽P&F4XAի(aTXzr#T$R2/RT?nWgUp6_aˑX`Ջ}\;/_ΝiA n4Յ=#LJtJPXM*AFG$a=4!좵)Uݻҫ:=(_);>bOBE1,S}(]- tՅejNJ@M ִ}y6y=15 \|k?.? TĪz~u;@?*la8  :uϙ? rJ%m>Xa$;Vc_{?JbE(W.ޕV{nM!{9VYx^Y|-VPl5[}s#õS0Ibbf`؊HW?1<}+}m{w+jlMqt5}n>>|9z .M Uc\|'־=Uv$W~Ԓe 1ozW~éOZlj\u[+Qj~3\֭✆ƒ4 mo6yLȭ/xvN¹[pۻdlNԁ ;^Mǒ})xdgp[yzGt].tSa$CcW=q[t66߻mijSZ|a #kEe.Jjxf=t3EVZinֵ;`b@=3J<_2ќֵ*^F֭*LSovwfXY}\cY2r,KOW$ʅI((\fKSͦ;MWGvd;eؾǢ?9n:xT߀ʫԎI_;~uҥ}EDLJ[J6kr~^\Gݜ>ØZ#jܔZm)G˷P6ǧݠ\m$*崘Yl?wj6W=n/?X #.("jZQOllsR)*b3lW};=VзzқN{أ#{y󬛏Ynw UO(\ؼ5v¦,|v4z{NtsUzx;j>I$>X8=G8ԗ(wunUhOڐecz`AS!64+UYjI'JȬí&_B8,?*<73`jhc8۶*=b,0gVY75b<&s2y*ű}LH_*Φ@iӿsQ}*97-O0"xl۝TR ݎ#3uė HL?gb~jysިc\jjEܴH 졅3Sn؄?*3W8n.d\Pg?W&yGg?:ֵx K,P]2<\/nq]&#Mr1syIzWKU!Kcmr=a<[hW3TAr=MK`7ޮYߩmrNѷC4gjï^h95Vf>f-Uyoj|±I~ߵ0ꋻ@ݒiO5]nD֥7'޹ T\W^UUڳ=}DxIQ\oҤ4n"ZqI$}Ӛ[+Uu#QjPrz砦EfjXjK9Ǧym[ cz|Jk{q?@ZSV#+Yc۞ךvvfu4a` j* ;$YDeC$n}€:x8$}mKD224TL_;|s0^ieo%OiDp@_s3qXVu;S!ѴO=06ogjPզوmԷ\obx8brJ_Z跴dkQ2[;TǛ{qbQNrN ڣ|o+o&6=P{%IXˏk?|o}J(fZRpp7fЍGmm&;MZ]Kk mB%-ui0 IU,;V:o%Vv[E-Rb rX6CP6rrv鸓kue_ ݬ* YZ[[ ) sR,ŹO׆~jy%~%x { Jcs$ѝ}G{W+_4XX$Q6ϊnaxqBl^wsi:YxT.s: t7h;4o{4ۙsnwt4'ʿ2ʥ?21V8ES9Zǰկ*'NI+gˑ_ܠ;x5Vٿn$x:2sڑ2ŌE;zV4,,>Pң/i b ߙ^ƪΞ 3IzH)0c@3XB[?2 n#4z-Zk2:=bo.do3}Q P,Xǭe$[woBzS.h ghm1@TT{ :s0mW$O_ t+ PV-9vnܫ}zVI8UL֓b-β6cV;?$QúHJ+ҹ5{{90exaӃV5Nܰ4\;R=N-snGWA-'f >o=qRV]i1 ͞j6eo4ן,/9 UI(8fΊ@l]UPYhqcO2ZPfOQj]F\^m-&M=B6ʩ^53Hv*1oS`yַK#22{nn \ :ʆFۼ+`V#s; {\ID$6vHqVԱ(uVɻryk#\+T[ ӮjK{x-$<|N=cRJ;9$@rsXڻo )o 1?=Trq;JG$^ r6;L̖@A>V9M+iV3<?J;Hdy0۶ rU&)~?uZ=`yO*QzٙKEteh:MŅc9M2F=#mn)O6y'8溈|yʫ:~9OV9PTeJ.8t'ugszZϖC̓q\LL:x~8nK\OݙO;I=a u~"i|B|V>y{cڰlۥxHc\ɝ጖hoSu#?prC ’7ן_;[LAa lAmfRp>2-VKPhknQm2>0T3=F~{i>.Yݬ.켹[wRDU>#|@A /Cx-KC|&˶ٮ!H͹tkCK|qӼQ驮X߉'$֧1Sy["9S῅:6u9*\Y>%{a&]1"ӚGoqYCa]A MPp]#|7/IFi dMs#5ƷMiqaxbܲ X2ˁrs]18et|O^|='6n.SMCq;6LѾ/꣔=+'gj^og[jV_>"}d+j%W!fAKn &kioVnXW30 3yaRJe,S`Ǟᕟ$]Bf ˻OBA.x; IGAsg%㗶|Mlu9fHn-etnN븁ac^-Ѵj9ؚbψL܎6;^?OI% 5*8xd]Kv#;I\+P֥6tc0K#y8aB}Jt3tNa~-X2[^}ZT+mogk hV煵-IcCc+[yp-2YP|$#*q7Xᯉ7^I$cyrJc %8wHluΓݡa(;B0:]0r*;-l^zsև`0~N5 smc\nBp0=9/ߜn%ƹQսiqwS+4o_Ž`.(?*j3/Yc4fݽ)WZi#wL~ts~l 0ޥi:\nϡl?L38"ZA%#!z`RɈLn0[jA] w<a{7^+@»=f4fy6^)*j㩠3dҜbڤ}@A;{Tray{ $W.{EK 4eҀЄ^իi 7oQjMLl+o?ɍ٧KpB$D9_zZIe޴s4JXrcC/ kk36)*h_gwjKJ~qޢ?u[4o…n*dpOkfj/)N ץO^cp>dC'PG'N?:Y.q@S5RK_0dSظ֧۟ ޞO&6j)4w}{V&ӃZs¤aqdP;lng}my;SP8[^FδXЮ{TM9 (̞<wE~Q֊iO asM:IXpsiCcti*iؠ/҄s>YHҷzuXڬGؤNN3۵P˘]~ *&ڡUncJQ ydS0{Ց?.s0;S(y-K ?JCkaS$WEy*s?lvF/y㧿j &]_J-NWߗG>QlrqNu/;TˁPNTJ]Cx\gح 3zv#2t40/ʼVe}OR*c?yzQٰ%TbsW՗89qҬCw檳1jӸ`ÝJ%*>cMp?SObg (ip6z@~^u 5 Vz8nZ-Nԩo tTiw'QgZ߳G*9w(lZ ŷ_Ϳ ?1(m3VkbL/MߺM[%s|٤߳,~!fz8e}pk5Uith?Ym'ƦxSW:<`xJ<^mR-:]/OUwvs#}>Q札8C {ԋ"s)j߆5XP0y:wKր:Ox 7qLW7mWE6J}*&嚮W9iFasYzyAڶ!e[GnWw/:KJƋ9Gvf>4eV14 hL/jE9P޻Ozo["D[׫ jv=V㑞R}^1> si;>pE0z%gUfmsޠ#~Z $|ϵ9,v8M[8?A${cנOUfYr9΢TnZThi[78>l ?ZHB==_)9NX%v^b&Pܚ7O~*&9L͸78lCO[tֱ|G1EV5b6zS ƳTSlPuuh3BB"HBU ~5n}3,:T{AtSKҁ\ޔ}[=*KN3mnHn@e|'gOTz]F)&cǿZʆF9L׊OSEYLe웏ͻuIFɦ< dok`N`)V+>y9L++ q?Aǭ6]5WvŸE9R:vހ3M)bUWj/7t@`cR[ƀ+2$޿VSqޚʧ=̧b?/95)m+r* 8v;gn xN2=I yۥ8'|s_mC%('О=̤\_y~+AR5Vݷs͞z{|> Sr8ғy;f̍Ԏ 6=~ ӹj`mJn~yϜuiw<)hOSYYwPEA ltF|҂J7SU'p+VY&tsPRfw_/k|` Rxsߍ|[Sk*®_ICc'BXTzSE?_Ɨ5ҍYpyq@/\`A7jѱW[1$ PGSX:/8tk;7V<#qb#a+//];U^{ fmaPDd2֧ChݎwD u)uy0hR!mcl~hxt6Oy4w,@TOVx =Cƾ /1cKk"jIdQ7wzOu[cɇwIǚy>g̴:sALD cíMLHpot׷vO~:.V3WcY&0+zdVD34dO;4\Ov,+%m;\ɡ7{/X"n!XX l2j;yVx[QN ̏"ЃDb= Lkn{zTq;}EIl+7$~3ޥH1Uڿ)lB| 0c$⧁ 3*b}u?ʙ$ ҫشyc)ަVM K&+CX?J Mn]N=?e63i4Syd)mi$C%«a}ߗZ7:Мۼ( PqGϧShV9$čٕT[3C!N0sbnY'v-Y$ h,;?Ơ9R6[ 0-[vyqAq(CT tFT"Y<„g,<~ #J׮&E_O_67uMBєDeۡP7Ti\C [ " Kpnag`'w*VTa+zfj]$EVY.8$63#n$l&LCŞܬvvw 1+uw<,pU+hKAE}Zixl{c$1O[uM5rcʕPd$|G)Z6\#åK/ ܇X+9~hf12K8 8LT[m q 1,{AQg+<~wsG6eHⰺܢ 8d>ddb\+7ͦ.e3o{f41ˌcXqAEwuxRдxvRE o].Eš_T]OX~f+ [O{/6͖OVBT:QWMG⦘)}jm"OȤ'rKW\|73g |K<3lK|m.!!.F\c%K)>ZM?ƾ]6h!M/T89cH*2Tq"h׌g^\[k4rY 䟝]c;IbjOa|߻-†QJnTسMm$3"2 G^ %;oOhGBϟZG+pye.=84goE=*:N2s@CT&M Cqߞ1Ku8f6Zr`js7JzqPr ӢnXT^o3P^(QT?zsspYnr7JIvYοjq ☃'K(+fS9'~hK`kFucڥ uޤ*~cU d#9 @\㷵SFT3Q:.?BgݧaV ~iFsRx={N)-h辴M;bF'׊۩sS}HslV͏&OhAq 7]nzw=6_1R[Yo ' ܑW~uZpq5~@"?j)0f*Ts!#brFCqSr0A=)HeUIc!UoasQ~*%xهҦk=6TZFMۭ x:BfZʊL튻f_ vڒ(qW/17c֢V/<2 cqqj҄n}>^e-$qGXV8O*+BAf|;ͱrǡz* ^n?vu+v"6\g>1A%2OUg '~0l=h+RYC2{Rw w8}}*P*619ykXɌT *?μϟa2a{U2XhWц+ k>}һ)i5ժy\5t}hWexR,W&YBݻE7O*0ǵV|G6@$s/em=뤱S͌rD+vKo1!Ua{8ݷ=>oǫ2(8VTL_O=)SQ$gH)sM\5=e#^nK:vY֫$o@OJ xɦ+m?lcV$k^=V}n=3Qy;_£22qZkޠy1ҫo'&K(Q9t@=OJlC´o-)Rm=ǿּ`3ezaV;Oj]8m*ёaW-/DD,2qu(Aqmzo7uU>$pyxʿyTf5=j ۞hw6wfuV,3JҮ@L@ՎR hzUoJqUD8ďJFF ,w(@eǵ19₀;K~ME' 7^zӥer(sQlԠ|Z"7^ǔdGQ9+g֨.ߘ-$Pz16kVǷ5Ƒ2ޘj_jaG˻T.c2gWMʅkJ>tDp{$ǹ6XXA=){(E=jԈ6qTI[T#P ,m<n=:֋tԑ%0njマݩ<}ꙏ@$r/5D6xڦKlwqA_+iɠlӥ *=h22֚ ?<ݩ$ 5P<78?eW*9mTi򰽹ޜ,Z˗r7O۽+b5e{6l徕2!_ Zv;uҟ 4.=v˷F~o=&Mϭ\᱆Vq'?2O34733;s_RY>-^j4qZ]яBDjX^{@<[|A\3HM۰3}⍴'ŋFovi_34d>zW=mΊ{5ެ?Omg2mZqݘȻG'UG‹ǘc0nT\DGusӀci:۴[Cimܻ`FN{W] 5k.[/m ̌27ʽ39ۑ8TGcULjgh>ao&FUQQ5|? &?:5H9pƸe֣(`v|rI2K~1-*Oz5=wghnC*+N9M& &\E#.0>}+"X[ )eYb22sח)*wVVIw/``N) p/UV,y7 uc ҷI]^ Y~]d?)G~푣X+F7du_mm]MʀJ/Ϋ&N K_UЫHŋ1qaW2} RC"Gu9ⴴ$*ͱNާ9b[Y b<7-+ZXeAu" Io*Wr"rLyU>V)m2rqS@"9$f /[#8V.$ͪ2[O~zoa+"a6qL`=MInFơ/";>9OivZ敥 `=}rXN2m2 qdXi"^I&;TR}y+XIaxw71N^>_˓OP}:*PF$b)BZ:\j?-wBQއ>lPaeVx*յ9aAVG¯5b36nҜ $U[ӚSTe jg,L˸8Nዋ{G%C0#rRK-͒%ޔ-F1sWL2#>ړ5͵גq0e|aL6&}:2ѲȻTl.2I9-6qpxUh=~2ʽ0 U~+C3"*6 };jfg]̉L.'pO#-ƕS4岄c՛]B:eKG9߅O̪WG 9ϲ]?1]B|%ni[Ao#*whmU6<MңЛs4b;g;]>emk7Q2dF/&[͂ۛ{fvǃ,2YIⰒD>^QsbȈ}Eq"/VfGkϷ䊸Fֳm%QĠqzEQRw3 mTA'$w=_kX;Sg^;?*T*F=OJ|OYI >`:W]}q<$>[+;Ǻ1IX|`[ip=uE_crɿfy/OQVc%+Y%dɛH tLVs f#vݞ|<կ4kBOg*H>"?ŷֽ{g ߉o'pōX갰?a(9KX|(v_ k:LzmeĎO"PKougD㟆&ҵmV&]'ѕt"^ [ma=_5>$ S4D']6cChAAkDmQhԌ4713Y#*xD tc%Ic5?j>8, CIK$t*ӉNр ߉K}>?A8a% C mӳ8_Rj:N;]:V㶼_.iE.zO6)S# <_x5u5}qm}\ژM^I s'$WMS]{COK|k(mdzl#󯄞_m'$GjWvW4[bۂ81M\\V;v<k& ofE| #>T8]?[oǨ>um `3D+_elY]N)V#KkKVּ3ul%}2@-⫡S/>&zYd;eCǦ15(x29>ś_mf/JĤFҀ2m3!4 |Jxz#;RVM?+^j"VBҫ#o*yݞOLSO<oNh\a\rtWhVǧo#s*@=y36jUJcYI=\0HάB3t5v$VKn]8*wo>JoZevoOOzq+Mӡ5`Ft<) 9[kZ'ڳ"uVyJH?´&< ,?/F' -6YNTKG;֢f~=d;AAoH򟛚F9#ToƏS@q8@ސ=;[zS>jqMO w@ aߵ4wZhwqӽW1ocRҭٺ t26cҀ%*8v&zMcuϨe<4F*0Xj_-SOCd׌P2LJZ Q[L>HR~Q@H#x)\3^3*I 9+VcW|G/OzKP8?J#lm!m֑H[߿FlNJc6åBϕ@<9v{P=R#p})aov4gX>N>QMkfi >Z Js̎xZhJ# 8ETNL隫4l"$WMیsHVlS@F Hw1z>$ޞBa3*xK_%C: \'-}>|8=( !Ur0 C!r /{w7q=괌&q4&|?l҈5=z՗yQNDcҦ%D0jC}5I֨Dp8Um|7Ү@~_ڀ`V#Scg=|I: {I펵8 ooΜ@iOzS܅ÕH $wU#{ڵ [,@\ x%_zH@ n(mgmoWR{* Ի1@ɦzk~0ږxK<1'BEi(Fr[E RI?ڿ=Bs9lxcPv_w.GL=z+~!aޘrp4ڨ}8}h@/Oz}}*E3sު\r3Je'^/V2õsvϽ{F,<``@#(.7`kf>]N>y(0 ϸm(?!\^g?97G!$"0Ѣr(3ms)=ayL84e2æ1Pp?hkh/ˍ^(v U CןzKs| " rO3E#lV:Eztߴ9qV!|jnA={]b:zPpqO΢kl/@Sn;duKfP>b!׊n:9wT~I SD۾PgUƂu!f#Hœwe{SَIW_Csŗ?vץc!zXd펕&6߅V,8 N*=M0qހ4yVHJU\5|9 ztwX=j-v nݶZ7Oj²TkeaޝޣՏ)T{wW![b%QAy)}˃P#|W߳*wo(K|ߎ;PPךR:v/!8JBH-B?+t*V%PÖ^Ӗ SFy9/944K(P >D}NiIxeݖy {$P2IpqE߭+"=ҀGERq֬H2*t͸Bչ,ESw>j%>jQd7^EN!I"|*7ڿrQ,97zmuM*nQZK}|OCR>=mz),ϱ4u귒#^y(tO ]NwǷW>J.ʢTI{FXc=3Mu#ҩC<28eUW]\ULNO3yfefoM|rCm$Ur<@ )*0z©3@ɠ g>jfP$Lb#J#'>*~jrw($f-w2sNk{U9㑸5-ZԢ|ϼ};N8AR6=qdS|i^R$OkBK6U< +6pnR.:UJw"#-)ce_**Lc<.1^% a~vp#Xa3ŝ)+j'oY< 8ְ3V\Gusv4k _<: 12Gz'Kty'BK9573I VVHħsL~Ϟ4)#c^aȒ#*Ŀ0,`vj%e3Uzkkf*ˆ!1D ! ZGg c?1vgOp\c^9gKIi$2\ ݸpVmenFC\׃Yl4-MXvcIP=1]ɺKR8e>gŦ&d+-9YiUHϡk{,oƻUz* UgVuw8X cRi4Ӥ媒\Gg2/V~1n] Jgb6{՝&^b?|'Qj5ey@Hm?5,aa GG-Q$B +f B+˱sgWEh緦3[WZܮr$Ȋ f70I!F|e]ѻH@$ֱ#QPbY$,TtT'g9sW>ۓ*hq[M3}[ qAkٴs ᐏCMnAjn#d=WC8_1z#nzZXkveÅc+\v{ZB =@p3 z }H6kմO:?-'s4czU{2;"܍u/OMUOVۻoA+TMezq(ԏ --ypc "QihmNJ3|8n#2?3hݜøTm-kto0 >ǰڷ- fB̊vGs\֫+vxV4M-V5 kF,q +3]27o@Qxbܲm8WcޤՖs.F<{WʌkZ]в>xLrgB Ȩ}pMu:bç?*E0Sb{u-84ex~Ŷm;Zkۮ 61$[8~vU⎒ʱv ga+A|xBuVZakDp.S\4E.ůۮBL7Tbp;I]ΫǚUwm |aq]\!sy<YG4z߆4\Xe0F黐JȬ8$+ n|V 욤}_ڎU4-cb c#r࿋4$F?L1#RSĕqƇպ]Y^u5y!hJ"Wlz?{I? X[?Z^X˽eC}%϶9:FCyD%ܰ#ȊI ѳ+ ދZYZevh]妧Z υw_ .4 u//2bQty^3x^OR0K!όV-/{]ZhU|[]WQ- \(˼)$t[|1fo.se2ݦ$Ē7sur4Hs_ EIuwТ0g[<>eu)8|UngKcjqL}I6m*yR~| ~&u yQg$B Fɐ㢦pzVc>OP&kmOpm KwEk93>7[' 2jlgq719Yt:d3C#:Gi Y#>_>^h_OiM;ŞI3,_xEr:A/.)m!Pyap$zk-hhQT,rFzPFF HNޘۊt_n*3F~L(ڣ#SsǨ4 vP]<8/;\@$ 4G?h˸70Oʣ7U9eh(%ǕD /7/z;&ά߇AQ;{t"KGCkq{f[w_jv.]8w!DoΘBR5yQڀeUY/r?HyP+#;ݱNXU's.wt ?ZPFvt=a"p9pi$6@ ;@~Oڣc)p@5Ցnw/-6N*stm]g=GR+8>/Rsң0Rnﶦ%ށሯXC{T1CG4 >?78nU#n1ޡf ݻ}hQi+̞g 4 sNJWZX ի9d;sUXNE xWH?1;UkAmPNUV4VW%n}Tew4zuMk fy :گCMg PW9}YW>"W0w1ߝ3ڸ-bI\|o|9ԿXnpsG0n~m^H/ .Wl=Zݛ vUw<k,6Av6Nj㍀/T8}L؄|õiQYHʷW+,Z󌟗5K׃~2ֶ+\h$yuZ,@}NkѦf >oztI:se*7gwzr/kZ7]_Ƒ3Ni('ڹ PAsZR:c |GPL!Ϟ?ZkSƥRGj,y|@[͟uj߶^*_op yb>4 ΖG QљXZhSNxgg5r`r~oҤK)˷ҬEk$I qRydqޣGss@}PWN SV榷9n.anϻJV/Ҟ#p !zsSĥORq?Z2|dv?2=EWKgop.m "ҦU9a¶qHxV6OZ!Y0TfUКN}9Mnv(g*2흧z`>n{ҝ.1'\FA'֪ɹi lӷn㩡=8 Gzšp^ɺF{T=j𞛗:lc@;AX~n{Ii~oSh 3"s׽:`}jݫ(zӾݑ\:|w-Vsj 7=jXƎ`f9Wn?ZmMˍ[KK^N;zSR.+*mi:-f9>\sXՂwpV_zIԫrBdy'i6A1ms)d^\P-RI*:n[oO+47WmcbY6iilݚqM?̋s ~i,jk4~^=;6I%~Q$glonzv35rWWojDEڣw$p55.t1HB;v%'kEV͕S?_1zd,3Im$;s:M;Ñû~~\;ӑs,k¾yN6P{ˇOۅ(e;{{=2{]@ <0}$ m0<Ҽn\4h,lZ%^u)ȃ-QA!nNBÎzh-nf]l # ;9~ K=Z,{x)ʃƇVVKuI tNI$$WNWn6 gG^%I^mQJ6D67)kj$*ЁwKه%r5FJ_ [9,z`r9m", w$o-k#j9-Zwm#;2N(Ӵ+)$рj??*gyWInnv<52sx= Q >1ڂI K 0|Nxk?/m+3HG&0NjMWS;\#+m$Hݡ*AItYLHŌsBw5BVuFٮ }U+se[ =_k!s}*lr$hinJ ҥծey /j˂9勒ܴr{c>ݪ d5@?1ɪRŦY窮($UG܆XyyrK߹v=@֣bI\y&}s7e[2Peջ匪t<5i7VxVF'9Ҷ-{l@$p%8ZGkbe_m*yjs,7kM.T.#XrĆ[s4lˆ*nB^\-\Y̋_qZ,ڕm}I6ok濦Iِσ=={EΚ+[d;[KSӚ;8oݼOrz\WJfX|ֹ︯w;)\ g`͸ʊp#ȬK-˖1]܂gSӾէ?)$>3W/E7"˂8>N[nK9fRzgOq]Z.(c{rfS״頑XF˽@;X=j yH[U|#vl"==d0f?n>o$ǽ$18jr7wM!_,7 ܒ8=[`h_8A$v+5Sih/q#EݒO`T<#>%-]rՖ֨H5ݒFz}9]ٗmnH>6u4~-/d)&6m>^;]?źlmUlj5h&Q#)q-e-׊|Q.GΞH[iʪG8p Ch66SC{[i-8\##H#I;?hմ)ŭfMB`&IdJ=@wx[_d2ZI\:N7,?1VufLϢ鑪n'W,V&<ݤfEqV4KI6FKV86"ΌNђ O2sWv:N6S6ʩn8z_O 76k5[چ`r%A!cn7yVMỽ2I7ʘ`p~n~ s3Þh+tR[dɫ)?+5bR9Y[ o0ʽTlHQSg 1IPF =b}ݿZM&VlcȦc~fU0ԔZkeO Y2(V֡ 7^ZElOҭE*ҳWSV 3S; ŀ{uBk؜vW9v*8 U!zg5GRhd{wԤsi׭ħ'W?ysF]jg5f=i݁6 XVVi6 XnwJ.qy7 >2qjxuGbI[7N=A<6oEcp ^֣SF8ϭ`*rI'Ii<+Ei= ={f8ݿ+fTPu~zbzw'B-?AUu;-[PIc?0ޑ~;nd݃S7ϷJ`g^`V9)$ӌm6K-~WPYsy<3i*Jnϥ+4:+ꧥ~o\`fS#vcK9N{u}ӫtEsM_zkßҟ0(n&l~[d-5sՃc;h(؎eGqNiY~kVf}ט`OnFe8\vK犩uȬTTor c뚖\Fbޙs3UtzWc4Sif!z3/͞k9^D%SXs6GS:wp8#9WsSү3#ط8+l֢I*ӌylt ERFygCnklh>t|}j)-#}Ӹ9",ǭXGONx?7浴 ޫ[HC3z~!KOt骿z6G+2ߝrcz+f-ޝ+~.iN /c vʨ I_̑3_~Zsqe}6tG=@9Xr=Q tܞZqUVQ9?H}*G9ǵ#Zh Jw hW-~,6w_V>NA}zuZ7V\ƈ#'u(GcT#{֤q3 YpثݫH)8vhLFvc^9TpEg0m\6 c@z7r:#u'Dw)5 ѻ kٱ+uSB̤g?:nj | %UC.9U! YyڤM? F)E"qMUQ!AJ)y4Ry+vQՃK/ޢ 6=ri^ncL3 ԏcnR+L+')·yV,SUv݅*w*ZY|?Ipjsǽ?qހ+͝翾iȪҪs;h4/{Tf\*7TrP+!HY~=]!p6[9QKs叔Fێk2U&ީS̪Ŏ_WmUzԦYjnq2;jC{ooɨnR퇒O+h J8eWo鞵"Hq0sˌ8XuOh&9M.ю\WCMemxn)nXzΤqG vU:mT:OA@]_d}<\6x'#jr:Uy#Z+28AET*Q5c֧GS`! i8X;`SD{Z PĞGzKoQU?ڍ P$;S| cH$TU8=z՛Yڌ8s@??jǚÆc6C?7Qךؒ7<}5|U[Y~8Kxh=N\eT%K$pyOӚy(GKwkr6;aޤ|?5b"bs9RA{j{~GpzQØəLkѪ -Lsҗ+c˟UI`ߊN\ 9R pJ͚ދÿ/*A^Ƌ01D% G}Ok$9MsEsxF>t>K]/ 89coʤNb2qZtJ.bGk9|ub4ʹkj5GYz"0XSS`sz0=/%9;]e͐be,Ңû2e96F;^; =Uu$u#J;x쒲|]vm;LʰJXGRVI:CF?eLVs5͟% yYfƳdo(H漿džt{uopj+)ydp~bT%='{ڄ3b\*SP|I -߉X*9_I 󫻫H5ͽny$޸Fq1r uQju6* "UJ5? #0£ۧ5iI$u=k}Dt$.)n?w nNp;[x800}:k(m.3lxOVT8Q5Zk6LXPF0ýk$K>[qmTc?\$d1.Gg||` NkYM)}Ѻב?'IhV[E|`UϮz $Zs;22לR}H5sek  2}*^5+6q~=jl+@FcU#өTudRM45I/Ӎ8ׯkE8RC<m"ZEI޳16Ҽ+Ö/y5dQwRVoXe| ~֒IcA4ѡ|r~l Ξ՚9v2q'p4sFi77ǵRLwInx`k0ȸH4YeF*3z6 Ai%\qra:~>Gah̉){Wq |" *J7I2"O$㌞gNiMY֭K+1KS,}J˗Iy5x @Xu'AyV>$⛫4s8- ޴2?~!hUXu uV,"-,y } |/>Y-qj58O|4,r?^K,Ə%ZjfѮ!`A^DmIk<9qxĬPjmF f_,ܩ_[pm=VZ<8o ud6ZdyfnNqg迳K[vv,s=ԊY]+K[?k#KkK\#8 8jgcSF~y-`-@!V_g~Wk|=u y^+)dlu# 0qE|qRhz-?CD~H'HVܠ`"#׾CMag0+#0}AF{ֱ疇\6sT.Y b̹ZCmiNz\T3A\ٙ2jnSak p º1!e{E,{fa 38n [qhl_AirF 7,sVΌю~nh/?=BXʘr3W~;=hY ק=퀞6wp0k:x iہcÒ'h ,腰jER>4C# 9OuKhsd.p\+q"$ݷ_J'[uф:9Xt٢SRGo+=[F?3REM ?U3?J40mEn|=MOWG>fՈ?*(|Xs-8@z{S?c/Ҵv>~ ݪziHH9U{V6p;Un+uS:{{_4ݶ\WXRr\Uw"j9CsֻfYQ>czUy<ÚWEqFoz.cҙ@ZN3l:_tԉڕ:n 犮6s]h3>Pt'hc$ZK&Ε- 6v>P0ݨrE~y\QIK)9sO0q]Vc(O#H]O.8ϥ5tj9J9$zwޛ̝rҘ94 nR q }.g~>UOz]Z`^͏ҎQ;݌U{VxL}L| w;AzRzӊ.]1.Vyw +ڼ&n,n8v0{i"ӻ>k3-/,~Ǯ[2R}|ɂw#ҿU_ _ MS1ʬQ+|r٭G];UsU~AݾRCOLcQfsQ2_#٧2܃څ\P^W5ŸnoonsD>GM~nipP֞ EU+njK7UYT' XP jx7) )qK 9l}Hʧ@eQ|hG#,OzcxSχ?ڡÌ9?J5aݓsTlJ|7 Sg|:uk@qJŷԉmvl䞛 m}ά SƲac*ż,qԘX/p1M5%TQlej`HMKTunⅵezPgo=yi1uAiÞV<ҁ;EnuXBUԃhnrzjVsQqRKpSf~6iWm^Xh>l梗ĸ-EC|u&x­^qW>2kozɛE|xťsuVՋIw>L zk{]׵IWO'n!NLt늁TS~~?U ikU|kWj դXݫuoR||R.}#WPV9zխ6BDBcn9]ڰ4mCһ_ kHHMDc(x_GY>Z3WГcgA_l^&vY1;iYC`gZV+?A3͎U{*Ͷ4ӕW;:43U֕ YR)=d}#K0jхOcQ q#NhQ1>#nN1L .T¢m)k/RH ȴlIקZ4 Q o }Ư.7uF9Ͻ@eɧvM9Na4oj/6z,[ٺ* 䑹z5ҩc5R$v/9W~О //.i"Y[# nA<.x]+?j#_ g#w.ڲ0ho_sJE|EMxY%Pg&o*ß ,"0=K3>3=Myrk-젝eۗ\зA "#5x-B6̑ܡ#89AY tĺ6 S! 5U~칐QJq3y9`V~Q ~Mi^I.g2 gĐrk?Wѭ]B ×#UrͿV,Sׯh6{_efa"~_5z$D%nfEs=s5 ~țHZ-VdI+(?uG2OhvF՚ mf$"qÁө475fPY^Zt^Kݬy)\qG>w)ld+3#lsdz98sgQ($Y#褟9 Vw+"ˇn[?[׊ƶ%<{SBu̫qol@D9Ǟ=깘*1ZwūgyrձsQ鎄]׌#MW+фNM̋$J@G*KY-(;NGs3KާT9mc]dQ7~`F@=j. Z">:W7ƻ}BqDqd'}6b[h"-1 vg>Wt9VMFLw>|n 3Gkñmeo>NzV2bmM0sJ~h*yRgܾ 텭&X% bRyCֺ&FUdJn ֿ<$|g<*]܆ ~?icx3Ϩ^B2` I'ƁZOm{k分9({tžrrySN\7)F&JAYKE[0Sc6,۾RRp;Q_Áռ3?I2\:l/uK֑|R;{XXd@'WOЈJCGU?8r̪IMߌ?YZnDžSEjE VIxc#rUbAy$Ub: O"9\.ziLcͧsljӈmc/NZ5vb0Cv ~Ahfs0qd _ GH<wTH0JGO%ru=b^P%@ҵ *j W2w()Has%{/Nr/jĸ~j[v?Wi1}+z9Mho\Aod^Gl6˸.,rwsxoP-nb#;~f97deYM~`?ED[\"F$x3I8̿e546hpӾP v:.#4Qr& 𖭮_jZkR(KQ '(XԴۋ.hn-e̻WH&l%3_ |M"]{đgmrF߀2,O$皿^,@]zm$>P0W,~f @ ]sCݟ/? F=MH9KžSE`R@jz'dݍ@ )'IjsPOj`/vz vЂAqY'=ٳ:a#W;Q9.>*v4jZ@P@?ZF~P&=}@JYquFj֕cMDuIOZЊWhOU]][ݠ?Q[ئz:T2j?:0{'٣\ ]C.۪DT'H~J0۩kN[ Z>e46qM7{/py'Nˋ.>*q@"x/=*H}/7=׵4pFޘlV{jP|j(U#mI$Ѩұ>^sf@{zV ߅/#h|J c\!o+YO4}ގ`7A{Uy.r [;cv8Kݣ.`5RH=hО93+NKtwk R \֋5J>%ҕGՔ[ab9hg S"yx7qa eirG>SjM*$oP1n=Pj7gZ`-$Z)54jhdu/TN[t OF\c*߻ߑJX`'wӭU{> `XiZcy5I9EVgja*ۍYDTff)ߥH7ڇuNGj~{mrOZ/u`=دW`,ǰ0LF{Gmhb6F3c&j/w C.c&@*kBq*tQ~nPD!UGSP)R1*9_osh$%N^=qSI;ii?ݍ߆;F"M#@}h_%AY0;~N@J{L.qPymUeT_ր-=jݏ̀@,Pz'.\u1 8L]16Wik])PuSY~\{@sJek6UU.Yj1Ig$Y˝kkup)M0z+tTJa]FW5tiYsSCi'󫓶r~UB+ 4˵>+ ǧ5,3l2z#B6Qˀ1V'g?/MK723kNQ6 ݨt*f>$SDV4Q+B WyV%0OJrYo/2ȳ#/&*{$ձ䴍UR>)ETl^O\S֞]:EM3^5@͞œlދ%^c]ƨy-zTuɣPޤPd-֤M}0UﵶNc*Oa}) o?6icq֘lnmOKcKY_fº(\Ǹry玽'&eVr=>_Xb0r7 ޸)xW`|Eu P3L$qڼ5d=-HWlrD}>ܠys=Oy4ra5-_(V~1 aiт&d`=+OT8|e[䅶ts~VONCV=If{ZxuI ;v$Wzf?t1X g~RUvN>ӢW봿i;`Xaݳ*3`"4đ[m&h]5('‹5Y5qO;^IceOk w'V_?#΅jʞ>^*KD1e>U>jw5uhZ7-]1uc0lWE~xC{X:E*+|OSۊgoZHdJNrX?aP;gvk[ao|;|Imb?e_6U-5E%1t?zX컁*8#3y$TOL,o&vtDG2W,s<8vx%uF:V?WfKKgBH J(zJ򿈺$F6մ \!7aʐT<.KծbcKW&O^9ڗټGkc>\ gU9VyNU?_~5:̏#, +q#)?4kaytVA|:|r/uNKekX"<1{Au[֛mx o27Y3|#=X7N,;4es- B葹cqnІyhןM;i &k6;\,95+ƚu] qOslqI7y3ibΟcArDYSys|QIr=Ƈ lR8eW:m'h3tnkiO jBҵ/9ʞk083eE]Y$n2x .FdjyMΡo;Mc#lfhߐrF}jךM]H73Uz5Ztik["VGWxMݮ#1Pg_ֹON_-WTad^Eʉef`XOnW@u+i.:q.zrOqݧλ1LJ_Xat yaT30I<]8ju0h o%yuK6lh#P8=IwJ7e1ڿ]>'#E-X $GA_^>_Ǣ67zs;~d0'M}Kuϝ RZ F9xeu<0=km_ᦡj~gUW_+?A4֌4u]jFҮ>cdχK~ִ^ =Zد,q%'T Nq^#4¨8Y>2Sr ƭ_c__\ޣp>6w*,Hюtzfݬ{ϋ3iHPl3k–i= |7OUOO6|',*Z>Gsźc| :s,? t[Tg_+sc]U0LkOXf\ĺvnr$CaX< W#<#Ǹ?eXц!Gb6qu_SoeV tQ`0vOs޹s\tk?Ofl5c`B\wյ<38&ώ^W;? =u?z|GǩXdѝEn6+)9Կ e/5,]kDƳu Τ0FE vODu⻫I?cMZ^JL,31LI+IbLnڌ/ϫHXN.$+w |t>4Vy%O.P+$\`AB8#X\ iH⾟_{<;\xDVVwrZyֺkAvPUmm%ko3MѴ zU)XYאqO^~#0,S\VG翅|5 V!eCݬV2$c"!chGwG5mj)FKhnpU9L9n|Z9lS]Kb zq۽ri{?zǡwh}}xE4l5K;q"6 u_';t?~:?Ⲿ[k<7ƕj]B8&cQOɮqN^3`#wGd)l~} s@kٽϐ|e7ڷ1z=Egj*:)dRX|uU)!! U~ֈ%:gQHm}]Pgq8N sTnVlm=(Tu}ir89WsVkڂ}ei}:=˵H1@̛_-j27?wW Kڼ&Gr;>ޛh>GC?ʥIeJ!v"4_8ۚEӚB!Ȧ޵#@Ƅ($2d?/o15l-C2Ҟ4? ֞) 9zDd 3 }O$cڴ|']in ?)QXYq;jvB:+dt>4V3ާ9MxN~D=X!el~Ջcz"ހ ZpY2Iw > \]6'\jMxYXzl{~7D6Sq0 ۹M<%*^6ngObGj5L> `;7T-Lz9k4_;B l_x$H2+ƺ#ƎzC5=i[[ {*"})pއ5[kzFٷ) {zPnI]3[.ILMs;xt6ӷ?xF;O^kюgiv]^ÌK![?*[f+et m==)i?;tVW\ڟhoNt>r/Վ2:Uv]~Z_06wSp{ŕqtz ˒锁jZ`b)<5̯B{}jxAUJب8ȵUnjS~~"#ۉ[YL?ZAӥ^_ýWU ^jɺP1֪ Z3@8ۚ;l:}zQsҞ?.5oQUa7N*@%TjuxSXUwS陨+*3 רL 9M Q*1,ondVoSAeִyX#N(Y^p}qM6,9VgoʣP4ؠ~w7G$;[Ѹ^M c4xvg0V?/t:ÌSRh`As{z֛iӭgM"RZKlGQ=#'ZPJW?[sZPzT)lkʫ~TnH ՘eb8i]A@Va#}k?q=<;Ku@ˏv7} B[3Qg΁/oWUwNjA?hGr*3:ŻHFҀ2,n'>RM9=<0t֑zsyuCL(ֵ%}P;RTKpX=Tqܲ#֦b;odj6bu\5zF2c!3R3:{UZ2g8m4l~t so6SJyeW#nT e֩\h;ַgG3>ӭ vM gR9Uf}wco'C֨]J{ԁmMk}?*_ҙ! lXb ~j 70_AӚ[a[4{ǏukoE>kUD΂;ոͫҬZYLQ&zibMF :r&杀%5^x/9` Fj@g7yJ(.-L {|1@AyK~.pNZ8F0<K-*rby0G})K`?+~_ԵYnHm[׎]16q^KkjWQak=»@OYnA;y"w X7pON;dW B:[+r>v(n/Cf2-bsԎ}}ixol ozM1=G:1|*ͣ@wa~}[)eW~U$8C$灎z^mɴ#pm TJ̿k[dm1\s~>;{k]i \,k$*4R>w Pt(Hn$x"k9ȥI wI ɯΡ5 ~eo'xIAd([uY<(C!_.89R|rGV->>b[Hc?vrLc_d>;D\=nZBk%TQQtlV'oӬ~Є2HǖM;⛏[#Cx>O /ZE㰎w'jLw*xz6$HU#x$q SAoM+Hac.>_AO^sU|]ş{sZ|YV :pC7U[8.{Qe͜:pP#klkuys^C5_-r\qXs?_+Y;,mⱹPԗxe8-*wĒ[e6#9s9<.x?^#~7XY9d1ך<UVT7ai{Vڮǐo]*Ƹ%se 񝷙gwsQ7cڟ#xǚ瓫:II8 rJ9ZH׮.'Ԯ@DIL@$8=;z t+:48r̊Z*"VOd?5|Db ~\ߍ~kэŜsXN qW~~Ҭ/*1,G~d֊LH!v^O<RX5~^|ZE֥d ܶ61Q;0NsWC^҄מ-ވKǯlùşY跋=&K 4 pB`ko1-,Q[|DWA-ǯmO&cfP{^Bk}\ʏ(gkBo-GMж^ed'(9_^',[8o5ɥĊec}?mEOƞԯKT0Amg8ڇ~Y~~5[Mh[P>BZ SZ>X?_[mo M>c,0r3ֻo і s$zlז7VQ cpՋb7 ^7h1zPndfn1u_q׿/Ws^iw խ$hهRʎ,N+ ~Ӛ}ІnL]B&ڲvz1לW|-ľ5Ӎ+D,ダkgEiCѵMIn!02np_BNq;KzIqvq}[ #v=F;W_ ^][y4Am $7< |kZo__oeu 2$-`k̝Q1M-ďg` ۻ!TgryyMY԰[I& \++w s\eij rKBPݤQ=H8n6>-)ju#bGZ(k[;Sb_?>Z{ɫž.,n<0V 8g=Ԣ[{ge+Jcg-Z`o6MT;;`skCM_$Wjoмԍߋ.d8ӭaUL\1:zW /PڬOE;Ar1`~V*Aų'-EvG:m.f X2}vj&RfTqGA*/[yq[̑̇xOkamQaw߇%S.E}ϑsHo%iW$2:~xkX]uypL< ? >|?Y\˰0+c}\ Zm>`^uIw>)SQ_N/<-%o*L b?ZC^d exKu#\JgWJL ˰o~*nObH|+1t*=u*x#gTb+qUaM~?'WX$n3c= ѳ567cWNR]qrivJ8Ͷ"8FB^ -(FvX+7,y:?ݏ?80TfM4ܕh_jcJwZٛv@v?g~_,T_/I݃M/̬cV8j LjcNzs(=`pr(ǫ?4ϻZC`=jhB󠑣p#?\]cjs)Jq*;Jk ǯқ)*pP7֜~Q]hqQTzӚ>`rn4[zM9~QzH{֜'YuW׊aFRGҒc}JUv:T$N)_jvrPnO)ϥIޤiU mT~#$vAǦiԥB_ҀFXE#QsR @J7w=n-2 .Tԝ6;fMXDP}{Zu}HS*qӏ Z1֙,Y$3Qnn=hʰ*mz_';x7`>czCJ-hBZȸcU7_r;t4w*RTu!,7ҧ/s~# ~%=S*9F x5=O8=R[gf#iȡj7iWREkryl*VXԕǢ!zN"\~T1PGnýIjpr9<G wX=*6 e,*C%<}Υ޽=hlfiSP +#L+W %Z5 `Ϣwn}՛0+w@rx)k T!e#ҭyցXtZd'Z1=E8+u84E4j$.Jmǚ΁6$?)jKqsM,8*hd\X{cU8_-yUP7zrޭvWe!h+0l[3o9UC94v\]ILg4iJfWߵ2i8{S[,kw0zՉdps> nfUlu" ~Qzw_f8ۚcC k+ʹJlRKtdzڭDčj%ۚw2#{r*}3'}N:!玾C!=M)`?i](U zf@{>gqnRFpYJ-נ*T?zQ[5V׋5i:_/촖eHTEs>[\gv~|/־~Oa@4iis4r-<ɏ1-pḠWc 6Ik:2F [ex'k;RY*o*B3H6yLPe1q3t?Oy+}ZSY&|MS(ݷ 8vQ~G^jWPC}oX.f> F1\iQu muϮuVVqtP%ːDxA{Zu~xY-Y$|J䑌s=XS]^[]\;H\a oK5ziBž]r0=FzN'kThy6 m$Xi9fygd9 լWzUL*35i#ۛkUV9QҞ8=q2_?.5dfT޽{z0E͹Tq\E>/Vu&c43\ O._4rnLsDqzuӽy ֟mzs$;[fl(c־0k"ෳUwf9N8~+`Z31OTZg/祇Mv)k>PKѢ,k6:u>;6۹.8]Zȗ hkN2GLňHŷv~AG]xsƷ[cEn)>۸ zM>(yqy&k-to pp ?xiݦ0cP=+/u/Ow!W-ͫ0r0eXZͩ[rZ3=/R8ʢ(Yw7?Qג:⇃v Ax9<&ѐ>V)-uf&tiis)rp+&X_?gr#u\.rs8u9Q ORxh~H嘰(76z_e}oPo4;62Wv25mNq)Sß]mĭBݮ P2`o iE-*s$>u VvH98C}+kov[̮cir0\\d*?-"}.xaVBuln}y]Gx~eG Zվc" 1SFׯh>HMAM+g=3t_>ݠgqk;mS!*O5C[UDz5x+}eC㮟mZ? q6u!1 88TU;KBpOh_g|Ub>fqxl^H7OPdT;T~E54[1wz ù50U+hښŎIap;Owh澂\Қ_e\x@R( $GkF}H]>I>_ Sߎ P՚^VdRFVHҴ5 cRm'YI;ӧegsUVF?&##I"\LDIɸcǷ_1`lwo5cbo%c8GhtŹԐ+iˬAp멳<^16x?L^[y(զ{adܱZs/lMv䓹(\Cmj8,[*J' qB3 UdI:G oivėrFM&R6fO IMXjW n]EJ^?y$*GM{[^G$?WcOWR<\.]5Ff_%ncj{7vҼGn zd =znZ(']O 6v(]yzAN\8|2-a.zkqˤR˒<4Y/- HGA2*G|>Z!US/DXZ>pןSICw"6ob+ݾ?xa3FNqyOS썕*=Xbh\%U[skcpZT\3!?ԏZ/l];?dYZ2q)u/}K&gQyڷMԎ38+[F8jY]nsxa[="tu{l=*c7@&s_QNx\vj) g\@1@ 2vqN_/x֑2=:HKb5 ͷ ٠J98}j\>ZypFVe۷&Rnns/~}*U.sN/-~nh#oI"}jy (ʀ+:}V*n'M͞R1*Fks{ԭ }&xs^:ƒXه?75ZI>ދq@h xj7j)U "ץh@+Oˎ)L3G5Z0zH ;*" hʱ=W={T3隋w+6˜U.>ZA( KyJ_҂F'wvϵx=;Zq@3sMazlYVbJ"9l@0H@zcNl)|7_j `G=*Fr2#;PO| ۟ƙoN)c,(ۖTWwzk4]ϞvOU}pz#LwԘu(^>a#}P\0`,6Jg@ 99&_)e(0~F֥Q@W٪c1QhE-R3LMiz>yM\|zc⫻; )y#ހ&rP*yWvz֜cO (oL%>sӧH*[ 秽!efwҚ ?Zi]qMy@>w ۹V'W8⏴yi|ɤ;"PJbΖ!R&#;}h$.ޝ5Oak-%a&m55QMצQb玴I zw_'wtןI#|غan~:|66ti~6xUZܪw@cTsI!#\sצp:/|5t ݟʝw›mNM%CShvXeR1÷$ \lSZ5٤НM:OA<ƹ#VW8ڿ|Ր̘m;E.C%JSf81սԛ1qUWP N@/anl98J.3dOxvJ;J]m=(DEnU..|ֻFsɨ  3W*{-WP.Ox:?Z]'8qЧW%eĪgk_ψu]h9-\6A +O |!l@үxH>(ڳ}RRĕLnz{ "o_i&ad3s` ԒI׷O.-R2 FPkC)N1%߇Ok R̰ݻy@9E 9Owm/?R$4l'@ ǹd3PN?`?udtv-i ASZМm3|9ӭg|A]YLr.; u^?gױoê|L_ P7< N_6Xޒ ^bxXYiZڔ۩I719ÞF4U# eX7.g?9qkhG|HN;%msQ=B"m>ݬH>]d/X.῅VڌWѬk>pUm?$c>:vm&$"(Ur$ iI_-4?)}NWKyh%#JDet|-}O:w2]q%zk4y`{vf9g!m*,\#gZy2G4v|w/eUAZ_C&lPdֺB@X=~6MBXeHF1{b`=N+sE;iHp%)3_s]\]k[&$Y$W魥7Lɂ ӏzOxOcHt $c9*pЪtkSM紿3?$/ksm Cɂgs6N[P/O{;m(FT1rz{_Ƕ:Ƃi]iAӦS$*q3_߳o_۟.dlxsCw1 X:[3TxJJ;y8wPK]&Y$lʨ{i &-[U6퀹8=8gz$)ޕiҭī"󵑚Aw_TcuKtϑi9߭_>%- ś9'ۦW ;3w̭c[=SZԕ6lWs9k"8kz=7YW<( ~ׂ[zirYx.1?88's*75ռ_hw^ Z%Hp9su~oIg\l-5FJx+;KOG&?^L[|B'o$z!ܶRH8^OncZgY5׆-j&[ݻiJ2eT@O־h wS#xM{6/@O9ɂ8sM~|Zu)|I>EmmUcBz.|'qc 5 kcKa;TdGq_AaiaϞb/i^'U;u q%cǰTWti2<^5v?x7x8sͷ~&AO|75x5*x~κp6_8^?JiC李K^4?,WQP$0Odt9⳵_iMHV9'#q"0At:qXҵ ,)5mNg?{_x^k{d$I Itz+6]/GKYFdD^.1s}kVst̹{S+N{ҼSut}ݼ;R6%a6A%4e)-N[$&/'?_Y~%Y!He)qǷ?I2 A}ާG'Xu_29%GfVY:q ړʴg$p>2[sLw=K,O vk ec"ҜA)ͼ=1_S6g$26 s&Il@-P>8V +3X׌iنRџj6f#,lO$rww|CONҼG?UeAnAcf9Ys:i363~8|xa>e6 $7}_O^kx>G}e>5]EVqlUm4l}c_mO߂c?2gh9!Y= |&h;I;ţϨJb?*z{Wt*Eyc2B]x5 A ka-oCŧG |bT{r{}zUib\wHħҩi{Z5T/66R kGL]gv;ԛ6Ɏ1ך66{r'h!GKtTF&EWm8Ȩw'F ^% zJXcMYVۏG!r[9sM!ni8Ӽ8Z1*qD(3Sy?¸FS$r/n2MۓU, ڀ-I>٦1#A2=R4~Nx֘J}Z7۽:I_9?FO z:8w8 AO4q?:n6n뚞Aa?ӊRs{PgJq2Abx ^/7\R+8^iZgt6ެ=ºbtkvELxGj2_AEZ<ӯcL`uY0z?ySRa8ʻ@KUr}m8M).H zeQhԯ_@ɡ]t@ބ{U6D{EAUzjYڤ8_@̫ R hw Sra~!dtJcJFAMaWZ .ܫM*׭=e#҂GJxHUxiqyo曍㧱*aҡՍl{j?Nzɨ+ێejݸҡ)ӿ OSL[AHOJtp=qV2w*R~\>^p^~C~2oD=>A=s6D>Go#?,i]53ۀǒW!=Lyj.iwz뎕6X4cr'~χ!nsw*\fBw3]9<k῅Ӈzȯh뷓M39Of =*qV'WTjFB>9N 7n[4/L>vFlJlC'N zry$'ɇ_y9cϥii_S'q@^9v^6EtS޹myWMuU~FN_NkrLK?OZ JEï#;SQ!ueP=f@(AMjLsZ.;RU=XLv 'sM\z=8DqC8U3 nl9]v{JO=j,+4Um~B~)ӌc?8Z9@1V#ߠn#9={"͂:ʦI~\i 8\G;ɪOcJk34*?^()t]܌evH=:@sD7 zwǥEsR+|5q^9T=3HX3L$!A%a1@mTN>>A(ԀsުBiL/Qt€)MeX԰Y7\Ph[7j -Ү"8m?zF0ߥ@$3 vA<\k߯Bӱ{'bA*ןN?P.~_jKG4\Ӕe϶*Ɯl^=:hϵHs %ܿ"ʹKww^ۉG?z֚]LYtFcTr?8Fv٨(檃Z\^4IQy뷞-Χ? 6V`aQT]{Z,eOҥ9?^B+m~\EBE*gJe+q/b9%OL/^q3Cӡ>ha}ʤ>v; w>\U\55j2N28 kQUmd-{T cǶ}V`xƴ> #ōYErRRJLK"hVC)=5):Ӯ#*ӊoFjyXbdn0 ^Ln>yL3/^׽W3 ygHz"xDŽْ/#T5{R}6i99y#|'Kza@3ǽ} m| o DEH\xMkZ2>p*TXOlXl/Ƈf]5ۯ!%L.8薁C¾5-9.P- 6hfb7ۯq6y8q7e}3xJh24{H[3a=3_3jO> muo2Mh5|Р}&2pq?b9ZewCd?ز}89'$}+ğA nbC+A#QGӮ5m4j%PQD9 䁞*GK)t  9%~˫#c{I,/tyr/㢪rzft.aQ}ŗyHr1q{ᾠד50AiDS㞵c7}/O5psoh]_ׯ?ESQ쮼 h]nXZ~wNzu8+hV~n})q# ^e~|~&6-f7WLҬY}c&9_MNui%';#+R[6v*R7MېVKVcy&zLŰ~ePߞb)=e oSzBkiܬТq#}?iF"qW0>r~lVsjۚ(O_4(_iv9% LwxD:|W71%H}ͻP}ku6Vݰz ["凒S`c'c_OZ1XMlma^B#EHԚnX,/bIbҾ;v' ]b7z䭾lHa:0< V>)w{Bmo[fa sx ;xOm[Ey"XnJKr7'=9zy^dק5N[6eGMJ/v}t~?;<ci[y%.ʭd1͂y]MG Å{uΎ(m^GA_#tMGW]W CA`sj Zke/sm;"?_Z?, H\Oēמ 5eBK>~5}ڴT{=I L9B)+@R3`V}$:NbWZ:RrɯKf?SlYܧo<'g9.¶sV%&i4 qՏӚ?[ס_<E7TM>&Dvd&}Dk? ⬋i{Rgk_ 4u(Յ'oo#k|WJ|avE LYhqҿ Ms,)-'#Kq^#D`ʱ!hmTyu-%)K[*8£R>;N|ygocό)kv6~\CbO'I'VivUr]-|&&Vx FVK1ɉXrp<ٺcVwAWohѷM/my K^\lsy2(&^}+37'W,|S вXkWuUx}<+I ?t7m|T?ˏT@iq?w';5Y,E ʜ р¤{G;C?|U$P[Ia)ǁrGzTZFVLnxӠ'>کG}ilb[]A?9\ԒcG8Uc^e͡ZXa/f u;QH702aE z⫋yh$dd\u֡]wzĭ PR2drG]=g1Iyl¦RA/BZ ^&puo^H`?Z[S̐XInhXI洎UuÍi.=vuhJm~|k-*dmWP͞!Z  ~׍W.~[iaF߼B=6ҏcpΒ}Jm>feې;W|T[-DFzWm.Q_@+ylW<,bՈqP=6N5 yp9x_O9Tă!z1|4Ϲ[pA|ps^O8m|!qHYZLAƴn}pȳZrGp>m:2QbߝX1؎lӐTh (*9.fO*=) u{לO4C? -J?3}jX񐸬_m۷} dzҮ|h`jSq<5{ űKcҀ:(B;kh:~T}{Pn=}}c0Ȭ)}޲7,oKp67#ҡi3}sk*4=ڿ@wgZ\.6u}^u W mU\[GSj9D*^3,o9ȑ^i0;1}ǰZ_2.~m}jͽaYw{?,i\Y2͌ Xvz[6 Ђn.9p.BU>Uj8@^L:lNUsb 8]j9M1UTs8mP5_M~֓wSe Mu_yb*h|`"VFoRFaL/ᚎyȎ>ջYovG?M3ʧ,iH9R 4]m?feem1*Df&`5ۓSU:}f=;q@xhVhx;vw6}(gn~oҕ 9sk8j/rYj BWn0:ۧLx\~I*+n+olT~*?总*X~n1YiV͌v&ϽMywtK+@W=Q,}x恍tPY[~i hT*H4SmQ& s֚9͟5\˕0ZUS֡EUN\wO坼r V}G[?JPB0NӊǛVX n{PE)*⹡̜cZzuL6|P㰩-"Igg_OA<6",'$6~YTĤ3TPʆ<(O(Ӧji@PjP$wVZ<L-p٨^6;T\.B5N]J8Iۥbۗ}BfVsڤ kj2?SUU 9o\H%eq =1@7 m7OqWVd8|!ag+eoʾ[5,5_&5i47ez7k0(J'⾯Sğ ɠ|@rj 4Hnp_^;R|;2Zq bVާ;פ fcx$ξ+u+v?t-_>KǬw&kBW_GƿO5+Ɏsnn/o(lIFM}rvAV,<;fZ5m$'~VPF{|d~kSJIџ}<ϔ>z6?>x;Ztt1pWjy KԼ{B͔ʎ_/^> j:oONs,Zu9wDŽ;_ }tB|+Iq mOGO+:3=;JY J_s4[5Oj Ԯ-JK(e 56#2xe[+hm|cZ`%ćt8[Ō =zi\8g9.' A@&X/7^WoKk*Gǯ{W5 *~;rNsW?m %^ED Nךq7F>l4=:O7_ mFБr$2k'0*}$C\Ul-ӎѿn/bNq7P WWp%'9bG_@mhvvۨb1WfM9't!aBeʎ*}coڻM>t3#Z^]F;7-zmok(bk :O$cơ9[ӲW05"۳6Up{ιYlc* sϽue.NrJxK#X9n~n[c8q,8#sVM<#  gX,lsȻtіQy*?W5H+9IFZUXa`p3- _2%i`s#N2kZ5ҍg .}sbU(حĝ}{s9%qqx(p;F+sJ׵ ?yd(e3GckaU 02DK Que[}oo$ىq+ƇbI9 |(OCU+*+x;?ڳج!ṂAVk}B%HeWǘNvk>>RGLu$m_P]ϨeQAWZpIXr21,J9J|_6Gplc `GFz}9@8iYA t 瞇ڳa[+l؊^TIxђMOSK}u#g+bY8zZ- 2cx czcMvӮm|_>Lr=vi5:iѦG[oy i񳧚;_N侎KU~,Gps=ZX*iIm;sRkQܤQ  2=nH-o]Kq]o1m>+?t AnaLwKRLq^v$<ܲjIonYahU1;VbQdL_R+ xW5Fz`cTF)?xOV9};m[LV8-cXcQUF+.S++~=+.*¯ܭ+#k{뉲=}*Αeq$ ]\^X *㞝jZX"\kz(L E4c:ôcӱQ$~5ƬSu"w~چ +1);O=kqO)֋K!v棏+n=s]؎~S ZV۰+)hK.u)_u1ۭF<:D[\ݣ(1mƭǣmmw#ÊGOJ9C_I*Sҙ&4ctIOWg6d?u@u"pS[J ?/O.q1^TVCp+]wrSL:?h1>>cP~;q]K?*'+)r1͍!UjHwq5օ G4q:dhc-l5Z6QSsfV|^\}5$J ۍΫJj4̻;chN6:iU;Q˶@8֦":f[/Ne6unR3 [yZZVe@NxU y|(ۏR17S[IRjJrO)Cj61]4v_qbB_Ɲr?t~(zgkk, K~:RcH">Ls*ZlwcWͦګ$muzdUXw#0cV͏*3Үg=~P:_$g>6ͥd~Ui?j%8Byxq4Fl|x/wry+]5X}J?y[ҎV#'$ܫ@=8]ӗ?6wp317ʹ"<=]#֧aF\'4+?*аz-A&"nGJ9X\7( =* <3ϟ/ߚѓ?WLFzro#ȸ4qϖW^Z{i>cd `9E_Nrëzz Tt 1c2p7Usc˕c7AHӑ@d5"i$ggWњUxZ$ZBJ{M!Z./z{⫔\$z"r2 nk]Wʔz6lQ$ЁPgwu}qw c W8גM3Z32n}Tp7E*kh1ɡ3~͸*㷭vZ(^CQQ6jQ&vs]zBǵ|6|Ҩ\xV;H9Z;cwR{8Q wc*h|+L.K/bE&s~]NqX?SqA}>W`̸BJZY5*/*w̹$ ~`>.U=a_12}߽vGcϢeYvbo#u>Y8sf9ɧ4\T4] ~֚_jj1۷Њ9=\$vYݫCO 0@6J ;EUSF+jL:F{ ਀gal*+bDʃCBϜ},yf]ۀJֳ$ֹ 'ӗBrVŽqkB 5AKm+'85ilU פYUM\ 7nr̫ʝ%yk:gրe6qngC&zp8ǥS:i?~_@ [G/zTkJ e?*ZssE8*9Kȗoovǎ;>^oϳg;UiF~jhCoKy_]F~by8[]dcgZG9M07 V`_&9K5=*aZgWHO津HLWӖ(VdҢͿ_J"w78e)~Sz櫵n'ibހ/ U\6[˕l/`k.hC}- D;4VfN}:Vl$õH;wP/= u9~\'PoZzvo?6T7pTv~^Oui'֧NLw^Rlɯ+I͕zt-sҚ%[?k#ѭ$RRKch˵9ir*Λm yPx%Whd 1Qͬj[f|8#&i3 3^Mpt:<';vO~Ir:Ӽ<gi9]?Ít[qt BURDmX|Z@ULtӢܻƨ A?:GaԳ}qI>nLCKZw^ԞfWon),}y5Sȫd8fO2PRVXVБ{p"j@u_rz+kӮY=*wR/'jer]>Iߕ\դ|aG҅t} c8tvW鞕jtGN^rb( (/`}?hy7=iH4?N[OǵM,w^}* y4$v|4ײ)SQtxh}*Rم@j]QIt}fSw;R 3 54wCڤ.>Թ@ʒmL,㞼Y.QcE 'cmG)OG,l{4h\kwPW?ŽYVM;;_ # VYxtvֱ"ɷԭvm?xcx-GaVi )vזz6xCǒ%X$YRkb[j<~gz֑cɭE*of T$o)FB")>õuf_VH48)nq[xxX>ŒE*eFݰĸ;8F9zc\4~R9&(<=ұP;vrL/I*-^j=CĒ]32gqU|0VA''wBqj>/,BÙ d2{wUܩ(NO]i+5ůc,z>kR.#Y;Fyg;ُ;t4"ôdpڡk{p[ߍO`=qҋw6F6oY6ii"ick_HVQX]n=S\Ķ,$G*AyZlMK^'<4(Z=y%vql%ә?,p/fĖz<&5~e \d \o1XЭc?}3 ?QYCg)3cˋrK w!Sנ#;s q^)>|BYKUm۱}֟d|< CuRvpb,޲o",t +k!kx6Yd;I{t[G]IpB܎r;o&VC܎IrF;r bݔљ=p;Z0Ecr:-4B7*#sZ[U-eoۂ{DV3QcSVRs~\?Dn>r7pG}İ_D< $)9WIZ5[ۃsXNٽQعhzBru8z"|mbxg2HAfb2;}O5xq4(ʧ$z<hO4HsB?h8񧎵}kV$vĶKc1''G^w6kstg|U92k};EJ\P|Qgψo2]T% ds`zW-JVwQ}ti>8o.Cq:zn#5h>&ؕU`^#4oe5*_r+_E‹\~X,4!5k1,JR>;Ϧ+WKhJHIDͰy$r}N+=M"XǙABҬ1PÔ\W>դkjc<o%&>f0AJpS0+$+qBnFSxrzDO$*PC&OeRAJ{:QR䄜e~)obݵX,nrX.k,K.I#/W]Fid~uk[P% #JQor'+i. .#9hf6h*G|T;ңuY{9Zu.T7Dtv&Vzhvdqm:_ɑO9zαjЋ]HV93<4ɨ<dz~UѺ][@=HZD$Y"8|ߞ9ku[vCsZjaN\w\nkVG]z~=*e#CH5'+IR;;:{$?ytgĻ7HO/-NY5DUawݏ<~\UԼׁƜytRѤf׼Cq0@rOk,~I=&mБ+Գe_8ğ b+]ȤS-_P\)ԟ=k2|?qF;b9[ssUeտɨ֐8Us$]0HPjzj‹}MU~Ұ0{QP3qwuxsPKxQ4h3#8<~ms~k/֫U-RiOi-55f9D]ޕJQ6gwUd=k\ϿzmÚ_.M5s{:V+* fjQ+8B9+[eϭi{АHH9nVޠ;c#_(^zJM+psS|\ U9޴|zyg^Xyy V1.')KbQ埛hyVCǧ5]^[zT-q=.U~SwSy}Q[ӌm<d柖,wMAaY+ߟV-Z ҥhx]sU_]eLhcG_M?Zq;/n"geWI>˜6+&SJ֭='KT3i(5rhv[ fZ&_0+Z,^XU̓S2_Tم9? EES\uJ͟W6"֕-VLj9ךkOG_TTXyq@x\tUݍ޸ k՟,hNiqisAUͷKk zG-VӠO303M<'ր1Yzrxd^i[ Rud8`9F#v[ 7d]+~{AofUl4vҶ쭔qҨFVJg0ETV`SNRKZGjƔđ,wpߍ0Įڛ%9֨M.pKv=9 s RB{cX  $}x8ɹ\m^*@ԷAU Rg=z|Z Ӹ7vq$5qjv*Cy԰핷)l< w_µ_nFiX/cKx?ZeGJUW=jl[< Q` ^ nkc:s_دdR18>V  5KuHׅ[]9fJUZIקAJy<.{bz瞜c8@ 1?4p^<^ԨRHoiik_Y:lhQ,u=LGۯ\~N[Z4qiDMn0>lTL]/ޡt|-n\(Tw-0Ƈ9SI/ [1nUR, Zd.z+7SQH8F[P6ک\ž3ֵ<穪wn@aʍ*[45[|Tֶ8?wvRJ qMž8h]WNMG>DGoʁl]x]>CZt]:Yߡ}cz  /\ؾvZڨnZ8le÷i)pNUzbR3([|~xAJԾQ d*\.yt $cQ-?vϥzqWnEP[ ^JӇ+l*}+V5QCU`0WN\Hr=֣n=I E_#Uѐ|ڶRB”,.c*$O>r%X?:M)+5QZcO/4.6IؑQ~b{eOgaUԐ9v3O0NIfwn&i\m^s4k?gx\J.fO5Ed %'=ӚϼsaޔS1^?TX@ y!xRv敷sR5b#cE [sLig psU >4${xWG_t?q6Rp WY*6򪉙ZjGgQWP\r߅a#]JWjMUX Pɩ縬I/r9jڞ`6lrҩ{ҳUy7c&n˟OݓG󧋖 \#xTÄP~ҏmܟz7?Ҁ4 0'QK'/ힴ\ng sRyhm50[kk{I /lt]Wlj/ t*qwaP~$byodHu~z^"ʶRK'-BգgVQUFw ~=4 na+ђQ68DoiHCS{s^s*#RMq42³,`ۀߎW|*ـ|OҶΛmٛ-^: ig4ӣoǷj˱䲅Ud3c]ίYR~T,jֻmҤI8'rmVh?3 *Ǡ9=uQne]M/wmURfXnvr\nTntF=WP8Dj*9{2B^S`/8`=7f hDm!^ 5 WCʾ~>ThD^.3^}8:_xr_C`@Hq#hȫ'k,r$6WB' 0?*ds#LJ͈={GUi ԀT?c(C㓎?{?5!k{'v# Y5Cy$t }Z“LmL.3k#. r㎺3V tpYB>)e[+0rA=r4աF{ W ?ҳmoeW f|Vg=\O~lvaq\6,#4Քg#= ǥ\yM6Ap*}qSK)(vnpkj{,efYmv8CN|3sM0QL/uXR 5 F)0p9no*a^tJ:XΥGx×v:P6#rJ p8jݯṇcXk=?Z?iD̑KsJ0tDJ<lf<{pV x"<ҷʊ>@ăO(e%Cg$?fI5׌(GGh4sp/}Һ]Y(̱”yqc1k_9[>j#뚒v{Bk"W*~]RO@**N*XiaӶ('B8Nf?}ڨ錭yYHҀњ6rjFIfż{M]6ebBwacLx}j 5pOATedQG\z 5ߛsHCK/`&#̻zt0{{SWA.ҦMW\} ,z}w4T|ûwT2^`qQymޝhD=d7QTmLF%{ޙݽj[ïzuV+^><.rܑ[jX#|ͷq{(ƶ]A =R 4zS1Wmlm݁DiqI&}: ؊Pju jI9%XR2BppMuzi;i;_&P-zCץ]Tt,cKuE}+ۿVYܟ+qY[u}(,n:=5k33z}+M/<xm@c7׽쨘vn6=JՆO52 QڛW/ҳآ1gond[,;XR|B$9[&v~UD_N_1+:ZeT耿<{E6w3\HZ1{Y#12helɭ{4ߥf3/z҄4IHRe2 5o*V鞵D0M֢͹^6ߗzW߲kZϙ-s~/Bm"*zԙkJ~MA[1tj!tO>!W eǽmHUoppMV{UwEUO23tqQ&qL)WBm{UG*}ClAA'W^rv:-;+ >hxPws׎@lȾßjBU_S 2I:I x=jMW){t[;` G:y8_)z[/zUj-לuZ_ݼ{r[?Gzup?J@YmC~y4϶?J|%R>jyIrG jG P>lcֻ݌:p`Nm])hZ[v$c=jD,}=2jAޤ+-zҬqԢ^+8.(l/sLk=ꯙu>䐻PcҜg\|UUqޝ#Ҁ- T2 d1?K2@|>8FnpI1߿@acS+-U[.x ۞!YsV{]Jc%q?Fմ ]wC[=!s 4a]![1JXUWnT śKF+>݄nFӧ@E[ UuVlsUyp=պvݧ}:TbCoQ;ˣmg^ u˷ HJ;q)Јg[نYo2 ӧSi!_j7RO 3ڴqT~Yݎj)XtiA l'T¬7mՑp ^<P{B>aTef~7>RHyԽ;'{TTjhʏOVj$N:TUc 梒 O ֔'Q՜sҧ-pEQŜr}*Eެ݇jAn3tE)Z(^V#@N!s4ElEIxb/Kg A*ن3U͸S{jo͟LԨɧt|;_|--u|A3 bc7W o;澀.Զ1+!#S0<u (kEHnb|Y=W.Vq w& =jnT/%# g-ڦ KuHۭfUN8${ՏC Cp6nh)#s=QXɶټnv]Kª]zEϻeNx_^jxe]S }q\v=-Wf08apO`sk|ˋfAHvCH<f*d ƢG>k.7 䏰yT-Ozu0V[~#is+~#|F\ @[%ԙ-y$11t%<^|9zϰ)Ⱥ(}Owȡk~|=n[LLln87˜t7t{dm={ "[ʲz ׎O LG;NPÂfUBN:sUu .r23 â$[LjnbB)8<zWQ~V'צdn$sش݃A?J{$kRqyLv&ߵyڪCvY, Ov>RsrKo4]󭘷UH:n`z?.G9=+|IUR,C@} zQ0o2+9# [;{`q79wp l!O=MH]aqM~;A"ۦ>&4b!vyAHuGxI- ۷g-66qN-:H(_bmYmOv#˸dMC$r !=1Eq:3@SRXdD$jA\$:'s$_>c9Sw[B?5UFX^{3JR{giuG*I}?%΢z/jxk(^Ny Ku%TܽEwR˶ܬ #i8Nf!LeOqƠ֬NsqڏL-UaBqU֗OI^jsϒiiO3 >PO\}jխРU9~u xQOQj߹$wm8da&9Bږ"ƱUVXnUCg\:*\.݃ۚV^Xeڝ6u'w}+/Wˆ5Viwcj@*6r]x7fO,o}t K|02a 𶛢pnlDOE@[HIsxa6ĘEEӭ/ #^5as J"9}^(I!Y+a{TRDq[QŻR?Zw11@;x ʪBmFqV&ܼ|<>l~}il/~j/c պtH|}1; 5ÝJ=@--})M٬m֡*~zSiIo+:~sސZc9e/ԑL@zԿa;G/~ J:Δ{dPXډӻ&$U[w{U(fqgڋ9&;gR[A6{lf Zewt]3SB#)Qȃx_M?C6?*UPnV~eKE9`3J;W~TsU ?:@BUIZV}֕vWj3`jorrڤOc5XY>cNa)ޜ8(Ǿ)]NXvoҙF3N ]qJ]V>eV4bҚe__Ϋnث5$P'0ګ6zՈ*}8PM!dTe*Ut"֠ 2ZN}^y~^wu ۚ6 d|AҴ/<\t=sU_j䱐GqQ z@NaG׿znq~lzR C@rۯ><() c*hی?6⤍rހhӧ^i6cֹ& 4{-xqlIhmAs] rAM wukz+fוEO0ԊwTk>;sj6dҍ?BWg҇8Qpz~T)0Z;wwAuz"SQ;u4LT.O#@3l3ƕaTBzy>Hb֤h>míFdUdZ1:Uds&C}H)qn&ȸ(HJ6ho] 0|~Ty?}hŷqPƾSuUT0^0LgZ]Kh!zf'o5$W^a.S\5]oTCx#sG0royg#jJ=OBY_7oփpHjRE0Uu뷦+.nXz{UΘy=>6{(7AWk:[ŊB椢銫-O\C+ylqր,ʩ\ܲnqx*+P,{V7+'Ew0z [.؂qUb;+m?wE0>2:xizkhímd |U,* jD>UBI-xPn*OמQ%hVY8MF׌ra:i_3.R9+M$KO9^T-+tfO38PTqP}RJT"O-'$F9<`L;U_ڪ'̵b }3戀gzk&v߱*DR Wf{Wer(֕#6֛F>^(Fcg' * _=?5¯taMI-=3}+ڳ>&|6-C@v7vJAʸajvzY^a,-u>O<%6׾ϨC Τf7 }wVUc4˹aXz~<֬z%XӤx ف_[6cʌse68,LJx*VD`Im@ⱼImI +۵VHזd#_!9h}9&kRƁ76ٸ9ul%2DXR޽sU5!hi9;@5x0s,w*ntzyp K_G+', u}c5'$8i׶u>x;۹TyHn0H:y[Q DBY!H'=q4 XU6ng$#q 8zivJ/ٝ"Kf1ݳPc,dc8dmE["t3-lZ}s|'Tgy7F63g<.{qV0"sG?^TmCJ/63ByCy&`OBl!tml|.<H*d|<)C-4*gC HGqUre+Yi|B1Q1@3^"- tPV5QݱqobݣŔ,qB'5F]$/ۮPL 9RIb?n*M2c,H]w&KKt$-ѵiă@ {YI ݮbrOӸ灀zW j_C"IXr63z(-nu]vZ8NX?pNB«2crM+BmnM)2@OW$@oVVpch lvno-~]9 $eed$0$$e{ 1bܗC5}Jnn<-$3ymh$D5;%r%FS5-լCGX,oݮbņ5x-""nnˈFl?|.{skW&[#XPWx9j\M~'—q53H"|[n"Ǐ1܌~:[.oWhc挞z~J☮tc_!Sov̠}7R\ےG \:ilp&un7ye)0:ⳔbXs7}?ű|̂ k4mcm:`1_"xšڶ < A*̬QyHǮ;W.q{9$i k,g!#AGN{JڣCοdF6POc֟Z[ȷѶHE>ZQ$;0b!5r;jв66+,gQ Nyzqץ9v1#fpC^21Fp)'>W|D[Ηc_̺-ݤ~*8D'ack/_އ{ө@C,2Ul$jϜr?s^'m*]-. I?d]-m zw49㸍v/x`w*KM #b+ 2>{~upsmo4KW>q淆ZDYt'=?MJK]Ys4w}`orjvfrϑiƫFU=}XZlII JXkMNGeᦑccS: šI.58ﴐ;ǥ]=L`Z:W]?Ko2m^@hԻz k>^m.6 yY‹A4dg~v5g|dU-6bX=erJҽg{~%eROa85aI^]>{xq҆Egiq5voƕ{:oo1yyy\vnOV;i(NebWGnm!oްӵ7 ЏJV@ &&K&HdZW ~uNxw*!ҩæw}:V3|ץFkHOQC7 B=k}#y4UFc]ԉ"jX+5^%C RfoP=z ԲsY"ۖ?">Hj]*z>c~;}}inh \S2ǻƑ887Riw`ZѠH(qYZd,\ LHb=P˝Z_z ߵI,⹕$q\h-2+^Ok6UY>]~5^+fr:ҫ;ޣJm~K2ޫF.BsҶ0?Z-fhտ3Ub${՛xQؙB:v1/#=Qsچp`v$3JsLf޾$.J5X<W! s~c֫Χ~>e k4AU=_|ZQ;:x %hPx튮&(h\9ؽOjy$(o2 jtr!SSaz| (J]9]FۻjNI{Trr;ӄ^9JB'27=) bdZ)T{Tj* *T8Tu/9cj1=*H/Ig+|Ɵm Lu*?)9KE,6Vc/p}}mqUe,{PWBUC׫*Y*#pV А^[c \cHԆʚ&>C[0=1[QmևSNd-pqRwV;N1!T0&?wVMmsR}#J-w&huy_Zc>f K^}sօ'@9<~"ȼ~#L /3ǯ4]OdV^ b6J"={՗Mږxg F>d7*Ҡf8`@<7*2>Ïi 8߽#+)R }3M2i 3vdj3>v=>^zo = ;ZߌT"뚕]q̪֚01Hv)[otJ^Ј?\AZt&ul|mY3Roz~E~Zmޕ#_6OV nh{6fP"֤PM6;Ͽ52ހ$Yw;z'=FyKM-8}ߒ0ޢK׌UVVi;Ut"B7\Ts;q@)רğ)yr'F>p.XaߍZh,ҥޥ0O™F]?ֹY$^O,kdwlJɻ+ȭUa]20F+JQ펵 hGSTnaeϷ_zYW=>,{v :im4_@1H!'5 {g}(hUU@* _Vor(7Z&0xlb=Mx}Gj_0\Ӏj%W}js)QJP< wh;(MRNI^=q@U/UYV%Z$;N8皭:2(>o+BvۓYe֦=*J :)N ׮Ჵ* ,I< 4FO$qF62y8ך<jqp1|gjn\gjT+䍏N]Bbeb(=wll5Io$3BrxQq1cOL1tyƑyE:#FSaV WU \挖bP4ev'>JǁR;k9㰑v}j5hI$pG$5H4opr.`mvNr9sɬ),IXȧvpFHkSYZ)1n @OB8#+h(EKsB%`Uefݷ>O3S]涓s#Pp<ֿ%%fo<l }y4*iZC v#[<nW1b8;F=CWɺh2.d1n`ϏSG :&;N0q;Wj~O7˙fJnx8Q]bQm8`|QiQw#&#eXjH$8=~M.eϑ+;7[8;Tc9t->5͵bnNZ<5gy2#$YMNakx}#koR! |sggF+ӾaMqtݷ^6`enf_'Xf!P Q*.Qϧn>N*꣩{|;-c k d;DjzN*Uҭ>`HKA4]Rhddv rCaVhidKriOBXGޔ߉4o>aK+/;^Oaz $Qpg{'= _& V5̅ә4?UMEu+Xdچ[Cd zVUk^҇;f}PxY!!'Б==l̒8@61D;k&rC-gNZKbmJu 8ȯnw۴qrqю9%sqkgqn[2$Ӯ=*×Z["7sA+U0_4*MKO?'PXUɍՔ͹XA#0Et 25#21>b *FxY>mK :̺\,b-}b:TRE$d6nH}ǽa|HUս:J30n:b-_$wtv)d^=ig%Yi-[[$(s XJ]_bWh^IqX_P[Bۿvsy kB?3/|..1+<|e*ƻ <ܫ]y*ŷǾO$4Xv?eHF `kX"SW6 ybHWjsdzJ5Σ|6A4A2fqkW:6%n2?ӌZ6q|f."hiݹwfútHV_8`>=%^<*WL{SQm{tAt1v<3Ե(X2t~?wZi (~t6uy9% s*-nc=.5U;"ZiJן N3m`Z31mh#8HUn ֧v3Osɳj.7kOLVb0Ql?1#pʤ*Qӷ7Fq+Yt`ʏCZ68K)uqsU%O BrJ3Qs~F=?=wUfM.Ӂ֘hg~3U?3hܼ知 ƀ/~sJ˷Йց7smٟ~x I~i9I=跍뎕N]Cy>ҮZ])`oPl=٭Qx=*pzf%ٌWOoo;棴@P3֌P$3e~[x@id'JiݬuEnED!o߭W0Y}Ni#\Xx7cwMmqv =.`f#j_z.dظˋL/?k*r?Zɽڛv5TT~kL~_z4KqֵI۝rv5w$M +jX\֘<׽L<ڛ s=V'玴y]f}+){4~ht¯S\pkY *҃:!LK9i\iՐۑڳj[q?_ƹS46zSpylķiE1|B=ihd֢yK܁P N޻4&{<4csN-9*;ʍ:";NzPx.ԍ Z7D#=h[i x/'hZ,dR:t2EqOd /f?+cr.1Zc"]Y74͖ni&;ә8ペr<XcӵHg qVn6J-}wwnxH;GZYQxf]DsۓJ~QsUzHyRiI4컻nVGa!J,;oʛڔNZhs@ִ$˚&V+U_"E'hIOݦEtcyJ9Kk¬>n+9"</+v[Y͎?ZIj9 x\΢ߘҳnɭOaEÔG?ʣmUw9Z,1p=jkrWqQqrca*9MXqQ2":ӻH2ҧTG>MHj"]ߍ.f.SbuYW~/Q\y?:; w͓G;'iޭ~}~mHSe&^y,u /֤mK`e,ƔڹMz 4YomVͻw&En ,i ,g 2K6ZI~Uh^f9Z'6zϛXhǎpivqi97凵8ՈQҗ0rZʕV\^ï?o>7nI$ 6hzsFںϭp1I'=E.fBi㏂ fx_ E|1Gy.$^NܲHmM"y˺7z<+/SrolLcJ x;3og*gT|`) Mm#W>5ut[xVh!>=OzCvڳ[&f {" jHbLr\2 ^"+#i߹ Y,|DBG9`GX{z&Ik w1Ʊ8푊S40ͷeS;gk7N -Heo-<+!㞇.METG1L3.7'ojßښaM0~H#9ϯzVѮ%[j46tj~`yf8ݕ8x6}(_ Ơu83gݛJFa v϶;v~O,%Xlm=|_BVcy{r8afWz~N_ w޸־%2N ANۇº;'҇5|wbof%7W \A|ma=߇쵋T|hՠ?DjkL7"2"{:L(jrRheEEmq/-)-$ VA9|!' {Q5ǘVB}ZNS,M*W{npz9_3/u VU}`}=Q=kFg<lۮI!]K eYksyg {c ;n5Xdi>*B+:Qlڅ(kTϑCq:s'9"kZC ̭򭽼FI3_A|}mɫi,ڻ?ׇD:պ-n|B} lpʬqAM.Km%?x;*OSڹ62ۼGqjd! FH9:bToh"њmC4+GׯJEηTmgm͍Upq=kj18utkcgenuK3/sz?gAv!ӖI-K#mV_dj~=JKy,g1ck7jW6!2f!98^h+LjΛ]w,Q{zs^ CLdX1m+ڧHGg١Ԇ78d`mqkcѼ?kK}KR/XbK}J]Rv<5Xzn)o"kcz:-̋sw5Y><:եŎ M :iLpH㧭{)s|9?;]cV΂&sT`;B<eG8<8+c#3*J#NOY:Ŧe0Ԓ8Qyk a|A$| 0F@9FH>~۪\K1l\(zo^T5_7w7;k<[3 @F1q_3VNn*T&Ҵ󣮢c-V/ R99{{C!c\?S} ڦvݭ/o 8:aBȯR dC"nSpyZR1_|ږ[77"G8b,jWyed݆ y8u=Yiw"<,o];Uy7/-Gna,PJ3sqRu#{0ӫJ̧ $Ϯ1]ŕ\,3V@ Z|5GxM,,Ah"BxPH85̓+ۦrvF=z)XqgAVI#$݀g#k' yIVa~"7 nVZ;ɼ2Ѹ"noIaBD^~>"h崍ٙP3a9 1EAKwYV]Q֩ht~y.mI5/ Qgަ񈅴nnP)m>=:MI*IQ<ǫגë[#m?R29 Qu*cOS^l|wDjgc伄ak Eg-qО{W߳ݯ%M ni#^wʹP0pA k8bŧ;7>J6E *+9둀+go /ci&)m;puy-[ iuU6$l/6<ȱ9ެ85elji#L*t]#kv&Hfp^%fU>qxoo}c-C漲LQs~g–jPn&h8#'IşGNylI7y-3dvyhIZ)#Y$f1u]s̶ml/ٷvs_jW|֑eFǶA\AyV煾?]I,pV7rd8;'L33ɴ=x-.t(Tՠ` }p3ǰK>gź9T=ݶovc7 8=i ,[gq5Zt5]Xj9c gzTWG2O6{z]M'B٭hnnTZ4ωMy]flWVq:'8=zt̸QRiCDy m^SҢ))[ڳm8S-ngG6)`݇zRLhI me<^X7Ӡj39#ڭꬹW:õe_q^sD~_RkZ[egUeg00 4 3ǷK`:㎂5 c csޢkc"}7i2KSRf[dbW[oҷV>c&7Fr_5S6ɦt(zƽj^ƛ4Mk>''҉nO,| ]HTn;J4!~a{TgA [z iDZ +n8h{Ҏ@9/^3W-Z`_^4ƄGplL^QY>_ jŽsNhͻB6ڍ/U,>^۝-~UAT]˪jɚqԑ׭f"nRi` ,kIܧj|V 5%Q3?ӭ;4,u>uiUcR_ڒ#/03ƅ+u9 isޜuuY p3BisHG.5 qґ&?/zl?.O]:m0>/}Udo5O5՛?ʄZ.~Nz %Tf|q>#çZ:=bl V;q@INMDzp۴_ҧK0=@9l5F1.,<p8o5ݐL2F{Z"gh1XZ%HG̼tcF&\/n 𑺧?eYxzmܮ;ZxyGZ=_ef-5jV,41lXprq3yYQʥU{m!}J'Q9{_9}>oƜ[@fNX}}qӽYC~H=i>%_LҀ:sq]Ndpsָ N}hӫ*J΀zs[GƱt>]zְpӔyۚ&?/Ns]n]+w1AUfU  R#vjȭP[7d_@_ֱ `:JTcIʨ~RÓޚv.{S0Ef̉ׯzcnOTם,~4Ts"Tc]۾s U+T2ʭ {W1vb"O{PV:RҶWo[GW<s0\s+_PTuyeCo9uBr~s b|~T}39\ϛVjwhS]Es%֪$zznA3TەlT1VlTփz>f}M^Pq֕4uیt#?Jzt*Q˨FLw*)mvj;W+bUz8fO*|:{tN=xsϵ.bgm=uufhRn 2asHvKo W8F<jYxju+q*+_U j[ *'i{ # ]f۷SdDƟݽ*00ҴUH٢1>UJ lQg]pUR?ʡ*@ UU[Hy꿐L'8Esp1 2I$}+K3n*|,|)jճs[`Ӆ}$:zg󶷾:Ү\Q;m3ך-?

}I.̋m$㊹SV:3/uJPN2U4w5gmB1בQ%qPng҄I +.yg?Qڽ%įz6ږ67?Q= 1 og?=u]&7w1q+3(؃ڪ|(*7Z;[78?^?[2C6V>^)\dI&O>_);ٟSpְyCgiJ>f,H?q\|\]FZ>RJ/ny8\esd;C+?QNި &_2i4[Ky;۷zt 掇xѭԗo=3݁*:Ҹ_a׍۱$ #w;OA4R4~\+ .;9i#<:N=8>cJVQmE `qչt<]2k/M#B`Y]'Ww|FH73zoyN&c2J%U",灎?zM1,O*kGK+3_W 2c+ Sq= 5Ppѝz᭧,~ +m,nsш'xb>^o5-4/yX c\FNM{\jf#5_ JCj4oxq3\2Ǧ+~YUE-2/HoCF}G_څznXo4EП)=~ V'4kmSXPv8 3^}Jj38Zv:ŷ>HfxDKOQ1KQUܹژ^ÊǮxkw˥鶑3ywaMq$$.Ӣf\Y隕]Esw:[": #M9o=e9_xq4"9eǧ湿? /P$XKmH@ o1ĚU7s͂Dq2qk|e^ѓK^dXbFy|   6lgviS< ߼1W'HF ǵ?_VG(7;y=@5~965/:z VQ_y;UֺZɡ+ʹկ]pr>o?ƾrmjMz>9;?d-}O¿t6FSPd8+Սy7ýu > =gnWǟP}N*s1 vQ{FojSO~ Gx+K( n;b"ars#@q f;C_]BW+[zxvZ&s~OzAPk( kH2z\c֞bǧI՛`Fw)m[%Wp L?nS*e]q׌mi+bĊ"*sxھ5Zxt? Y1d]?-^5 7]HQC)i- qMNeo&F8@z!{dcu2&Jlsi2Qm]eo66L 6,q܌vv!89yZrj,HIؕHz9?һ >6Jo)+A<ZtSr=Ӯ-n$[vw`J8G-."v>[ՎGQگ@97'gpO L`p=; [nR+sTD" NJѕ0*Efq{PjxmoEMk+nݏc;kK][X9L䱙ynt:'VR Gpd8wNF`.2NqztំW.I -e # amaO4Xڒ'y߃o/XU*3q^a-)/X-vd'i2wv@|ʸd#Gw-tF+|4Hu VKAv u8#xUw {E6 DZ[ ѿ爣,iP>#fXHr#?uI~un.^hBaGyW2-oSsQ>G/ĽC^)7})GW+#?~4𥟇.˴X#S/Nڅ6"صřeW@%O^R>]|?3FOxnv9t=\e4Ro}Aʟ[OomZ6.abr#9⸿׺Mi^vV`5^'5O> mlӑ{O($OVLJu]J5Fm!'{7>$G%.yE$sBc[,@ 4}'q+ZATo{ ßI'?/OJq6WLvyC WoTŢjX騃h>Wր#Xi[ojƧvTEe-}N}y9j#C W?/*Y>,*ОõF񪒧 @gFv>t+SϵI.:w 94 O]>¢!/"(U骄]ؖE=j)lQKzK@m28OL&ٚ_N On!Nq@\`w9,{}ƕ>jp~Uj87{KYe [ kQيUޣk,[WUObzQ}tc.~ mOF0tQQ6}tX.8_G.rͮ~hZΚ})it;U;Yj91sZg2taA>GWD`IW8aG(]|*]}%Ŵu_ڃUzZ\vql'v8M$X.̑l4#>tme}( 4B[O˻QOf$vv 3+6}5km?'E̪sGRӡ|m=1t{|8MU?w`9wݰ㚍G}>4;z \H}vTX*M8/)i~OjG440;zP3~-1\}ߥpVjDd74 ۷קuD#QkY{]^U6(9^oF[``iCzُYm$LhP0O}*e[X>|u㚳exa\Xyn'R=zɸz dr+^;WH,Bfi>j-1ھ$D>װmj5c9kiTu{⫉|^Z<~_6l޵#)`GNhˌ_6;brݴ q`bned~^EU.c }kr%mN}wU_8[)'okx'Ḧv_U|[iYN >cɊ'lеޞsPu{]7#YռamF{Xn/B\yr&ʽ[ym9&ԫh{o5mxx^=?:_&#h2,W:5 ϩ5+ RA^eX3lVYVH7jmL]7XbJoF.&fkyp9fdkMM9=9YzGf ]6M/ Fr6֚K|޼xwzԱh[1o}+BêZPi=1V"1֧as+.vQIecGq֬DN6t}zd+/8K}6%Q]O(N^[7l?? ʻ,q3-ߔzӬe'4;?:EWUkӥE6Y:37-ך@QsO{Qjҏ|2Š5NG5p+1 Wqր1KU`J*(j1:V_^A p6v֟ UxMGyp_+t25<-ǝǸx*EܣҁKctߔck/ jO~\JYEmb fqqSR ӶjpIWFUL}iEa~Ԫ?^q@ 5 _dUOOƙ9mvJtvJNzDԗ机QﲪDU}+qڍmD/7zG @GNH\*\=*Hn6ׯC0=*Cd^p;UsvۇM;lPmpJ-o=Z/K׽=/0;~zZc«.P }(ɋa֤rʓ֩qH'gOƇit|Vo=-R`x.M\\n,fV+ ' }X|_-;cZI.Y} mx)-泼o"9cвGL|gts-2[s׃П_J+VXt` (L}bcpuY:MK̽ >z=kGz'"8u+B%&/a<ciV?5+ -*@n ,Axmf&pcL9gV1zl|)+G GMMGLֺ Ydey}y:Gu՜kpvH@yqޱk[ Dsi)#^մQiu_]iŦH62ǩ5aj;¾uw80:*9mQӄy%P1?PvMLV>c*QZrSg [-@Hְ|Q4=m&i8Er2=ܴk6<|6X;M*{>lԻm*# @ ~ΪOhdvu|ś?SX}Un}9iϟb-#z&%o&t,'lȞY#tTz1!saVr.Xtf/$pJ>;g*lUR. FR4]q}hxGDpO U/xƱvְkVTbvޟNkDәnBGX=1Gq|6 lT'?_\_"5 cˎNku\2*!`0 uOQǶ?[H8ϗvI,UOl{ƒ;K>F3+;\ۤ.̣珩+;u)Ŀev;ag'w NH.$uoV97|NrIAk$Y $Cs9\֯ZX\/8Pq Z% =PCa0>mIJۻVƛ-hV0&Uz`@lZV ~77ڔ.?8Q*A{OmchO0F3s(V]O ldL* 71)ᦓ}^[o3tN~ݫI&K.9yp/< F3_C 4D6wO\0-mi ]YdhTqEVSל!xl4V-D}韭hxaKu)rHB峌&x-ztCLx~\d~ͯ˙fm66ٮ' F~y$v,+J@//C ȩG*6PyڹI,+"GX2o_Jԓx顎E;v̠AE-#ڋ܏\դi߲8^zv=먶N1}*+aNxOlg>TPi\𕵿|RhnIO20Uv"x!2d[& <~95f[ -6Q wEooX䰍EX€9'בޱrŸ4ӹ+U[mlR$PWHn<$0\W]FiZ} ȱmXv?u4)'~;0HxMS]]5Vy%F*z@ M\<lȷ* l~by Ʋ M7oF[ 8Q).Xt-!{Lvk} s·eM9=>~?^VkHO*G8==ȴ/ &dkQl5FK)F Rޣc{.GI)‚˜n8.*3hҼWoAqp&kgϋwZL+%];M[wQ⾅CoY e*FxIEFtInKMDyS~^zY$W?6߭AE{x ]~Y;g'Jcɵqoڣڊn l}hif:#!|-KrEXVG xUL|NqR ڀ4?7ZGn|V64vj+-֣:?Ʊg#'q5OQczP2=i݁mqߙSWvG0KE 5^I?WՓ:T@? smWڣZj+@eߥHjx!i}v}iwfQKރtto( mP {2\? #*@,Zsqצ)q+:I']tFn1Ib9U>*{vP[e*ܾ?w I P6M$߽HTp=jp|ˏg6_j=GXm%6CY-Kmfk3`r<:‘CjFk7>UE0x/E].vkK ti 9UVUϵcLPFO1X&?vwV6k:f0oܿ\VE;gjޝ5w# @bc yϧ7~[sP'jw&+ٹR+-ihsJ~W:tg{qϥqG=v'ʊ\P[tGZa%VoE<) tJ5.PzzW[ZU(\X-TzQ5ȫ8G".hA V׎jCP4ȶ?ڠjVSojCj#bInoT.c&Z˞,ˏ}ko"i$Rjۻ3nbmPXNƴ1= [W=d$ŸOZKF"QHn41zץC6ߗïF>kr94dO5et {GSNce*H=nٮKT>ޕRkV#ԮZPtOU"b.1o?CT-P"Fp=iBcZMSz #ok״etm5ī.УuoG46U?B>zPҖojit%U sxAJ]ֵµlqVK5Sǣp+e`TP6$ҨWfl:H'<ըj%H;fnc>@rQ< .2V;E@ M)qSGhiԔ~t9 =*k._m s)xPvQ<_wUf_f4*]ƌȇjΨV0XQמju,m:浬~m5ͤKn7m;۷siܧ'ۭ4ۆ\v=?Q/+b|z lC6qTSOnj6J{5\^j͏@kMױURM' Vg2tu4Zy -o 3bCC4\zTg7t+\.zu-6j7YBYMtm*{lp)lY/^xYvhde|^9@|޶tłE{P)lzN~^FEi&ȸocH֨c fDG[ /??kqOYړME Dj01]~=iuEaWoQXqO94-;~]&[Q9ۻYB$gwv־leNyzPw?Rmǽ!eyƗ8>]nc֤f 8sFglwD`LtҀ$2;¤fY:9q!K,zPsR =j_cq4a<qדBj#`S=yzk'8 d_KS5Gu A!j߹9>{S# y]aoaҞiۍ-M.ӏj.t7MsVGnǜ40 "mk[UiqIo: 35@鏜quHY٧GL+e2kQXLB~ҞzmqFa*F.7BҬy <9ȯn _-^Foiv2 ;]j[ؖ6Y.6͑r1AO JK~'i5uH\ *G}d I y.k][!Wy}fmu>G0Tv=riVKc$ΏY9dRт'a&A'RC-iǧ6ٷHhا9z62=Zmfu/(Oy49[I3E6 M?R;[o5axz`mUs[O7FXHk;RΗG2n[y93WDцźs(ATk<FXg5sc<[1" '̸X"/Ϋ lIl1BI'OʉI0#oxc񅋲*nYUy{`Ik:~?p<\yu5O թjH,aذ [I?9y c]K2EtS?OVP=z}+] ۬ lϺ 29R!cڼ⑼tt86L3jGs랜k)G]K>vR^-Q$hᅑTJgs^ѠijIk 0WEcl3 $3n,_QM4gVfpT!\g5=}7 9pA81)ITev k[X 'j!jPZ* hV#{'8>],Oq."W;SdduWr}ak뇝XꃒWRj';iѤ+턖y''>8lvJde.8~5\o.Wz{Aᦙ]97GZ蔴 4+FM8v8N}qr_w=:* ^ X,r*+%NFPS{JD7\yip"!ݟ\ұNڳ0G:a#@K? ~b>? B, Ph \S#(z~[g\#G [;xF#8oը5˫"63 (axLHfFU/ GLdF#mS]Ŭy?e77{- +(x,sX`~Ķwx m`(x'_^&>Tq=דW|֣({7p:1#R=j>.xOòvv?t}2UkE'ql)aN0qXunԭu >Ů 4k;Bd6# s8dqZxPo;HK>},xd#P1aݹң}t{ ­BĚ'6Ky2 {@نu$I^[[警KdM.rgۍp8q\ޡV$6qIwdXc$j."FșQ:=7Rn"O"d%1q%'} $WQܡbH[`\u<zYIk[]%ȂI.l|!ˌ3 #nNf9Y5䓜:es8 9n!մWkdT$žNy]o?,)6hO˓hcOܳɴʣ 1뚎M7LӼHu/5R]fv#x).#SpLKō'Y X :cto{&BΥ&kox~H!쮢^aE9 >^ +oH(2zktzgmۏ~|r?Jy=jٷW>Ź*M\gmbaIG<(/ϛ<,TA qM1뎔vMmh|Ѵ| 7zPeL{syDңJr;rTn6iƲbsA`{PRݫ6hQr{SŸ4*F}S=AQcqL*Wn>M?לPu{qMRSݨ癙~%`GPp뻽H=x5"ĠPmUvRxe/NU:{曕_ޣOWT})Kh4FI? Uy{<ghu,w'iCC,韥NOTc9@.FҝʸqIiRlq֞p_-B8(6rW=De`:TvGe@ kmot]XSAU6;p2zTZRGO|ж[}@'5i s4&lvjeMӚrP[<:06I5~4ػLsιj|{#OA$ ~VH+Ҧݸօv:1@&_~(I7~beێ*Fh*%=\%ڜ[W)nF*n_Z ;$LNhK4ȱF>۞+S:pIڤُNG ::Q|~$TqL3}("=je8O>خXv8@~S$SҚ~W4,sT|#9oYqYzxhfުs5TH׭rf(Pf0݁R 'qem<7fP~-uFVD}8=Rri/& ?૚Si_7g+*OFϲ1_X+⥾qމkVfVfvLۚ{cg˵vx=M3fd^뻐}ky^Jd\sX cWTv$屜w8ܩ-Ґ{)!5r~|SOzh\>W8ʃ]f)*\~C0Һ~"N@;WK3F-ea;D Նr+Wmao榇Qmt`9OPW/TXn~RzdiwJ;!/JMTBҚE=i2ꯟ\fSo*B!M:?O@@X=Ϝ'RS\dyǯCmzzw 8鷊p@2j cR (c7_QUlޘsTOPF/^FxxYyW1Ԑj?0%|=qP`_oG#zgp,vۭM'u ljSPpҷUa3jXnsӽPv[zUw{%L恍4In̼Z#+ƜnץS uSQؾz"zd(=P)y=F8Eex>ZHb VI*ǹ5 YՉm,+mu=ymNohԽ{9X  [}?i K8#z}9UErWJ .~|ޫӀÕ?Lis #m=*9Yz9A? P֤kT+.63U?J^ɡCG0+OkC Y?QSgo(Ǵo~~aYFǞ6(7-g^֩[SM?zЂnך\֛,^ijagUG8=5%$dz{k1Q.y˾ԶnACu @!EVۏZIW늤 Ke7 Nj?A/Co>PmƎaضԚt-mSB҃ێǙG\Uf7u+kBJ\G8ϭhf=bؼ'e)ғ&Rwpu`0z#gRoPs÷J!VrLTA:؃ޥMI,ױTÂ}̧ҧ[uedHCr7 1;汯B5# Ժjͧ5v1#'JZ=/Q'-L*)ˑc?S^j˟~٦r 7tܶr^О>pw 㡯滄3L|\;7 yKU"{%~5ӻr*'u^!Ua镉lBI[ hBp2gp9Fp9leC72$4hbvlZǐn"}Go {xͭ[y<*F[MhiHMӾ+?^Mn?>svfԥkcݺAJB\7F2m#w߯XUfCnְ5Irpۘ$=BK{E]+;m,t1׊Ʒg;V*K}6{u#n_~ 6hYLRLş ?#zsV-qٳ$A\4hps~y(\!q٣Z) 2K9?`wUN1S]4 0 qUj[˯,0jɹA+pERƈ͋"4h%ȨNB9$zf3adLI(U r~^9Y5l,o.Bq3/[Dy#vyuK3MsXPƻcS&肜!$daA'⼇\/KiX[Ev\.8jj6< qkx-lpx9xǏ<@ЦU,q4"8I#P#۞*+#dR KGy$n%, SqozMh2TB9=;uo֍&mְ#]d$x۽jʖ)ayK 3ǧQ\OWcƞpg6 zoMDSd!OH9/ -XU"ݖS݁HtzĶw{j*COnK`d8U] H ?cUU!K2 #>tVVA.M>iiH-8w' sIr$O-UlaB֦R;QZH PIe ]jΥ+Kv_&i(]uҼ]g{_ Yg-:u5g]1kcx 媅 ' sg'wcG7g/Bkvv~V мAZ{-q40YK "Cu2-'1cM};5Ozsڇ†K{̡d\T?xoÚR=REĞ[^,/WὉ?tqZw _mb;Y"k%EKqq2Ȼ#+,w9axM>gkƿR4YAurN{\9)B0xTef_&._O[iw7KvmMm o0!\$WPԴCR\yb/?gu'o<֧ºo5{XUHc?(_[vO 6xI-]]Cpm-R$X~bw69>EGMBxzr-%m9o0n#|[5r]nš'mRUXݳ?@Q @;G 5\)iz^x_R;kwo}e4@Q X9jw:3Ɛ2Bʾ3<=ƭ+X-֬lT {/ !1>vQ=gtbwW+{Ě׈4[Xo-'ae̒Fp7! c}uo:9|W~d-ϗq2xk~ՒGM=>nzrN;g]O|3tK]2 )~lp|R\[X;]jVӄaki,|08G͞@SΡ$?CHɯ{HtW[*j٬W/ijo#";chg\NבZNHj5x͚1.#0$s|}Hgxe_Nƫq[([d($g3vHx'ޗcL!m`:dR\y35\J#X-'u{it]l lfJaAQY^$9k墁10+ό~ͧ|~uYT`ieQc 3<*\id^Y_"L2eTd I "<=xYw{dRW҉%0#'=rڭk֚"[VEf@89& ;W76Qg nVڌ"4 3W9꺬^)6/ Am6)F HW qմۍvK]+RՌ5˿9CYy 3؋XL3T%ta;8fHٞo011iA7`!Ծ"AqYHǟ$GzD!)a2sRt?jԡi[ F_qu5ݓ4yHp ^`;]koxfţhHh.72l+7?4B5r(lZ7"q~`) O#< Vr4U>Ѿ,iU&]q$gozرu,0$6"m.n4i-en8l'5jņആK}˶6?(88s8y+?bi폥QdVQoR9Sx|wXjA$^x߼l0~$RѤd<~y\٨^V̎hlZUV@( ӷJc$䯵LdQ}Z»$:YOZKf_Gm5Jtj]sWef~izqV"iu( Q_]€"lцSj;|R#tqZFuZts>;.92-dԀ?/JIaہ@L:b5 F%?t[^|sv"@#490|]b H5u}~x\NU[ UրFZzQg}-ZMcҳ,t>o]̿S*cYzcax<3\2+!p F1⤂523J-ⴧE'j&@1sw)$xcޤ5bHw7Ojڒh1nOn`;SμNd%=URzS@WHyN0ZZR}F(/⤌.|PJq}tɠ=Ls>=x 7j4GH .ÚQ{pI=ۏz9ϙaMg- :4Zd'O*??+f)b9_ufHӥ~'Cuv>3]2U{<YS<ިݸ%~$U\u9⍇;Z70Gzθٽf@S4Ȝ*eqRJ㿥F'锘'Wu ~Hz9wM$ힵ}m\2Fq]Vq<+~V^ABN:\Xát+qfoMu2jPuZ%#"J8ԈX6} /<4lӵ0999ոfj@~PK 9zXn+4j.OMk;HsQp4 ߭Hq#;yzT6\I%)GS~Q>Ml0 )p4͸my4߭>  LL@Љ}^:O10? b{4E7-R9ǽRI֤3dVc_,uݪ&;M}co (ɋҫ/ⲭkcKP }1Z#9cV|/ZޠU3'36 0'=;U.{w <ˁU*^=Ӆ꼍\g?0E,#SFҝi EPA^9+{TV=\81ހqLUz⛿Nă@Lu)>1"s~9?N( ؏^j3~FM$PF+SXqƏ<,?OZB c8ƹLiԩ7zSD{q@"nu%#+I V`rG5aN)Iqj_<) gCl*~˜*yj(OqJmfc~@aВyv~j}m@,z*ktv>*35,qך~5?|&ռ+wNaIUv}໏O,fu &I-n FOFʟ8 U[Zo 7Amd] w$yd%}k0 KT쥳>tuil4A1u=>ֽ_×+sH h;2qyNy X ]ѯ͓?*3u F̑l:IWzK-íʘ,ݞGoDԴБH u纑X~ u+FP\FOkդXy>SqݜJQ&!dݙUu(>5h Yn:~53E-ƮpB;&TƧ#?dJGsyݘ.dbOUj[= m#O3 #kBIV9VxTu_XB@eあ8#%֫4ɡLȲt1U%Ѡd{Y.O/.}H]~%*lXݶ bt>3AO:^VfJ~,+o0|x3ǿZza~'i_tNXxKtـn=*x|e?1id>kƌ4e'j!H+i#5>L6B㍔+,ߧJe4qy,AhF8'px}̢86槸0xO1l&&W^9ڋ\~M.UUa-#Eӡn BVdk8P=39ךӮ(QX21ys09kKDXi{A b(t~kּE{ngqpf$T_Rqyoۣo2H(Q=xy$WMj9n<'-)nz)\dVэW.DZ$(Id-$zwX(u׏jkn>л#LH.O\qb xᤚhV2&q ~!|Ou%,ӸT-Brzg=c,451oX` nT$pUhp!M;.sW@Z-GSmḷW ;?x ӊ[~!X nht (bޤ9V[=BㅙGy8qZ%q2Us: xFM`6#[ ) gt#⏍#'i.M8Y:Wsk(̇εIbXX]?:q_S4?ԓV]O@s$zLk$^tHs m<'3W`1:Dkh|ssJiQY%p2$G#:gZĖ^:Ne2"<- R/,w,LHK^uU]u Rۨ s*HB|1Tp)i菬 S1Kt~'{}Jɴ[]bE{KX.!:ک ,dBvJPd`M |&i]k]>o2=^\CCF[s/NiPKk +JayYl~_  c4.<ǬjpP52Z;0GUg]Ć0Ur^N3O+}=8_u$0$jZ\04FnY!NxQ[h^i>4~]j@c{)`8MI7]«o-uxgVt.᥇b1'o~;ZfԇmY)H#nbڬ dr=/i1xošz,_LWZqAmc2dža 53\}KŶV:Z*v~یWbY;çEw$6_fc# Uܨޖéc}{ MGb~Uq]q.yo&g92A E߽ILP2@ۊ֗] 5 [ygc%9ZއJs-wOܩ{w#xSZd;ye]$:+ess I,m!_I";{^}s:(\cxQ絭\տR}k zП:*J'C5Rc;@F;OԼIZhv^]۴/c3xL˚,p^5z|5B嵜G,V^3\m"9=,ePkHݢ_z]?AMZotQ*л=լcbq~' ,l4\5御ClsHGC pIO7UfB!Uhd⵴V3D4q$qtxERV,r,RXd!xF;[p T1 Uncp|R,{SP ykiq+o3GrY~f7dIwDž-'G֯-!k?+$sm#6x穭x'VNYc.(nQQ;'۷3i<x+M&\Gc`H3$HH9r{T9$ '7xkM͎q{%3Sͽ`##*O#ޝdpÓ_ 쮘CvA r$dgU 2_#KhP,Δvy_S]]8:8cr95&xם樟0e[E3B]9[1nvmMbnk9Cz6RNNMCokxḷk{/ EqF,Wj8`d u$J$D_"i|gnq\5-msu('͂ux$瑎G9JӵMufm|["9ooq)RVعdӮh*xU< ,hN r>zh=UUw8*yCtj < Gk;K0wl꩑9Tn]tQ1qmyUӒ8EKTiPZޕɵ$Y\J? flo3*Kt1޽B$ZM/sڹ$c^#;z~VudS_\WcQa= 9TF?J}Y~j]nK wB>J%ט;S_F$vW\`eԞaV#*ElRWVj\oӚ"qby%/q2BߓM7;OL`uDUle$~ێy=ʽ*bgZkN65]<}(*!qkhU5X֌Sen*F m#jO1yZKuFuTXQLdR68-if7̿zr$2~^0Ϋz']*hU~]iv6֘K۞$`5Ȫ|6L1S"ɸVM1HsFO-~o7gG3b݃~ݴ/^T68W.v5D^JR1!>e5jA'qZ=mF?^õzvga7[#qk'p _{Vܠq|m_ߊuG :q2nm*|+>Fvⳮ_fn8F^(򿋮}h 6}>N& ~vi,a> #*͉*ǹ@ ldgjj V_ǵhKc%VuT\l~:1s҂ XԱާjMPnLO֡ۿɫKwnf8C('8sUҡesӥ1`?v6DtG)x'~҂{b_(#SjWL6JyOjXJ֞Cw9<{ԑÌ۸`vH\߽V|#֣tOjĪ=OCNdǠ֔ FH֜x"Ю ];Io98g"FfѮ~j¦Ӿ3U>*`Gg֜ɷ(T?6_#n~.NGr{E'i[@ 8 >Қkf}oPo揘sWQc )Ÿ򡁞ָ/5"[o^W*)˵1ZgiyZcQJĊ{%QW(qWĢES!>5 Tk8%{}ϻ)dhLIOJ6cV@ /zYYsT̞X<;ruNsQd)dVI=(FM3:?M [85a,@!}4d5Ym7h=y)4OҀ2Me=\R4Kӵ0XF05 bU*4ïI?^+ Y1ڬlrzg$ڻM/\n.{9h#b8894cޭij[MLKd qT ChInݳ*#I83Ҵ4邳Ck)j%³c\֒V1tD8$;8o9 ϯ_J4Qrwb%cl0=}WL{ֆ} w!am$P/&Y#dA~;'ވt*ZYE ,nEe-Ү]S$|:;zYHIs867 ݇-[v?fh-ddиhE+nE:N̒EPRi\IWA5 I0XƘ8rsJŰm>u 9R1 ’GpH5$$kIdTiWryr>\)/pvӿSJV'Nt]C2MϳrǛ<a 犥yiB}-W3Zi?39֦B;ώ;,'\ՀEtI-VPyMorprpzU /S Gko ,Dg,Ƿ܏vOx{su#Y*==y93:{EwMfG950~TlZZ[: #HWiGbN8)XB\]&qd2mx᳅d6F#z`gJ^Jږkkg'͝ߞ>1URD*aZJۋBX;v"? ק|oD5n #4'?ָo׼AqteDm|9S# *R8nziRu&AhO^Z7M FN}UF^G 1[mJ9.noaYnmm!^31|4Zhx~M[ævv8!7cWzb-ˇH4bI.X4#o=W}kZ9h٣O$H<@P8fa$Se]@u R[m[e,U$H^3xQWP6%5$[jZ+6JaѰv"+ N>)mg\QPPM0߱%xNmCZMB|w%ͼך1PnG=zovPt^ɵI@ p_pǹ$7-~7c{kk+g35l]类.*}$0'Z_ 4 鵘 ϤeLyM I<}O+]>\x3!;iԙ"!2O\k>~K_lo-景b!m8%2㻎k17;J/ֆUF+㟘  X8 T[Iu} ?ӚF)̎uq(<=Ӳ<k:ĝBo?ub56,UILǾxNNԬ=&RKd1YQ[ 2+÷ _úL]N4qc&4 #=HzUîx/7mp׶4$Wr +9N㖇Myi ծv:S\%w6o%~`ny/."ͧhznGu-/2$dncxY0ʍ^1!cit,S/ڎDcuUpY0fx(MFH5Rޭobr>ܑeH@f8q2z5OhkSyl+[+vųM,*.9Hsw<~TL.s1F^xKɼo4YPw)k%wPFXA#_D<eꖷZ~rue;?Ц2pǐzV 5k=vU.Q.ymeG=F;R=J>44gt-`&HlSqt?Y]CJڽ'M2r}My">5WP dg,rk17ß YκIV\2xC4d9'Qau]6k[:ܙ$P9e' #QAZx2LסO[mDFؐ0*1PќNawqiCgiь`ܻnK;a'tRj>M7캅"s$"bV(qtijomop__rr \9#wDj&K o[tu*0XV,&_KY$.2ul'Pw:]GI(w@aazyOC^_5>$E`#f*ܹ'jN0xK58ggd~u^Fy>UD \]F6u76%҃ ,Q cGBj@fhx$t.H>iwf+R)~Tq,3gW(hvwP\xƊU)";,A}P q^2iwZqnC$IqdW0 pwW=nQ,mehkw+$1?(剌 ` \yivַ!Y381@S1 ^v6jvQGq"nO<#+յ>"yjm[%'{à>];Mg Jiodf6a\uG0?M*RԮ oan(6l rOqJ(=xylwbqlCI0A=8'gѠeբȌϴW=+Ҵk#&V׋xRIukpfZQkg̎rG q\|Cռ L#jvi%q J<+ tѤ*ٟD͓V-w\\O:W+;[+$dϨ5-Sx +GMwӟƬ}c\f.0~4e Z2?^zBz>cc6 lGZݷRg)MjQAR򞕷H)#tޟ)70NwsRGZc޼Uecl4 kLګujџr+GF,y77 "8jZ MvZuMQ-Q=>c\;*3YZ]Ny'ױy{NmMhDf#I\ K\ŸLlh}yV2jւHXUؖ OưDbbës?G_Z[%oJP}xZZm )g_^*h`q6Hz [ v ]vU`fJh:Cۯ ZwMkB4\wrhznO j@H2r{nU[+כQ&9<1K<(EVRȀiQ3N23c=OHd- :3'Z㠪Ƌ֜|zP"+q߽VMEC=jQ} wn^}ݖѾ\xGw]c&rv)=BOSķ=ёl+zj3#7&k{6`_zEԭ RQV@Ip*du*Jn{f3uJv4&șMGQӊ^qւkON?u2&`-#~acZ$tx>$k1 p~b:ں$@Pc==)Hq?egZ>/Jίa֞ck =Zqn=~W8'ATԼ_ҋj>f~];y[.ӿ 5"ehCc2,11Ukiú\\v8RJSD}=)zݻ`ʅٙF[ r2qV+j\j:a֗03ci ~ɬd}h)QLuh;: q?y4P% x?&hO D7jro{֣qМ[pGzH/S,yJ%*\bЏ^|?W2"svrqݨ(ӚeS֒a']ߐj-8 TM>n%zϋ]W?Uyޤ H5=ז<-'Z&c wkfij >:WV T'Nա,vC֛#M2q8Wd` ENs$gUe j C׶~[fVoyK _qZͅY9\Ӕ%7LTk!ڗ1hX㚮`gk-ړ֠k3\xȸy=Esվ\꠹~fV]W#bxn*~"l.eLx @yefku{SV7bx0ΝIu\ K:9v"Y~~I*kSψ^s9̪'5\%B6ÏzT(C;$+񊔾ۑӿz#nO zf iwݸ\yXqFsޥފuڦ}wk C Ո[-~H-U׷zgjlo)eP8G'mз3|[홭}?W{yp:֑ٛi,RVs\>6oJSɸye桇vD_,m:6+ED:m-;uYrY+cL =+񦛬xiɄvﱗumXqFS.pkof6S>;%XdX|H٫NʌHZn ofxZ亀 yv)3;834-ڸK\_*ٶ&Q(xжH$<3'+~kxPA&V;5 Lc?Z.#Y8#Ʀ4;U᳿D ! G=8r oɛ!][z;+ֻZ{KI."7 31&8b))t{y3rG>x[5 ;]CoƜw^\ows U[$l6WL\G՚ј1c*gGJj/SMhYdG 8OWGxsSʆkLāq"ɰz FWҍjխsRg'=㺼: acs$|h!+h2cNIZE9$anyfis&mwm$cUF-qQKK2A$Py u ⼿8i.veH2.-ǯ?I/Og;0QitjA ȧ +H,<ic),J  ּBm>KDB9BO88R┐M CrB_w\F 9$*0@=^;Vm0Cco4sy #UaӦ h) 1|WQKI-]<.>PǨcmČ;Tr~S];KS1K? u&뉛 ˜/8>zn7c¶@wgy .˸PppK OL]EmH8^y8$AV2F go\=x`FWp~t,]4p{ch~=bǵv2,UxZo~ \I,Vl,d t{+g*IluڋG^4,͹Nc\|ŋ`9_XX%Go{~ 0<\?,-mZ2Rry5e!-!ILJpz@╙&c!-AQn|/H.r~EsMiV.liq\ 9 ->:ڴSZv$݇ߜ9+CR~ $>e)xf9_j#s/dVV>9 1XbP]m<2>VמmVu3o1ʫ+4 5wGq\XXb}_Qx 5hm&7G`޸jf]KlP?Z4٠\^M 娐D99Sק4YJA䎾?*zrۮB Gqq\|Ct:M[̜r:lzw\zoܟݢGp只qqJob6i5)ZGHʌV?Ü~5.IZw\ qe C RH=9R5 h OĆ+˔ҭJ3Z6՘}=+gy5-/#4r[.^cʶhb*KsE55wEl(l$l0H6 q, .G>P_SLx+{-d6b<,q`abUŒdDzθ4Kf%C8-(ThlDhJȾ\/vd,9L6?toR8&'IgrKs9 ~/Hn|]FT6pK3"]6ߏ. El|.GoګB3Dg?@v˓2j?ca?I1!>՝r7`* ecF>Z~<#+]QD2,Τ[+̀e T 1_1m'{&Y!zy.Uɱ[X|;H\ {wixcDF$|E $Tsèxvx%;{vKY+{W]/ Þ&.mb7zK" +㔨2(17׍|!K*uROkiDm$xBvŵIybaэse|Tz߻{_ h"kkIp=f&<`EpSs& bx3Ɵm<'ZK$xUGCkqnt<O?Z~O Ȧ&+Z3>HW9P:`^mrV|y}E $xJh$UbWS54/T|^ٴE.`!#&Hxmd"<ǻ}wbK)xq-+>ot߈iw4l*̬#ZRN҄$R;?u < tڎ\@{彰RX+ ΂9#+px(,O kZ wbkMKTQv DD7P`jTd$+qAnf4eis`x3禗Y_JrIž-K`R+K&+}][U"tg]wᙾi:M^}m 3D)qB2$E/[NslNҌ# $TOvŶe.hO-j>PW#  OPkaTi{B9yaI vnbb^iz7K}OInFBm[srźr xr;oj6:-agZv$3G}g\j-A d8 {OQ]CV> wZ0,pۨFuF,`bŲpIŽֺ?3h$F3ud7'UmK֞kvվ^Sk nNn1Rdh74[ )gR5I*0O:y]2<>ְAufdݹeP.F )ss>,DVKɝ=H}SPNЇYLLpk~Emkg7vcwpyl$17f@mK}kWo ]h,'|#;yS'Tucȫ,~=4iu $M$hlg~ᒡ;(Zմ OxToڄd :*)]Us,!9ͱG$6dMFX( Bi,A܋+MV'DymZ%44/KV*ࢠuSŒ |~ յ=ĖXYj&)!D4$=sq])w+-YLn.z|Kț~RqT*;hךvOqE~q$U%T69 EMm>+5 l|Kt%|ė&F1۰N8XcjWkᦹ-YfHt#IVr@^LSRf[{s#,;.bTI>ge-[]I=[ȭș%8}eTU<-q~$SC(eB;3$e,6F@oA !y>ΓkgApd-c=k>?"ilZuj6NXlRl0`IPY:ċ]:ɫ5Ɠ[y<& 6 )d^ߵԵm7Kԭ]KkUG\YW X.9OxObIE*ڗ[_-g عNJ&c?v,8xGqo$(U),LL˸N(-x9?^+Keh/MW⹆9d0Cg=A5jmR-l.o4efWr#zխKVhSz9բ r0•k0Q>)ZQi^GbTbSVdr>Եe7u>9WawNI'zύ!+YP~_pOAkTmf4qGzg8Vd7f;k !`iwO1;\ *S6MO.d%WZ`goQֳ~ |Aq0ewcx|5F:\\huhrRy<ASW;IڬUd$eCjLVxy޵ xu}"V>c.mev2iֵV9X]x[V;yeϭɻrltd'h/>o¥>Aԃ}^`nsڠ^ ֺ9|2x[ -F$rg`HRq~jooOzvҍGrmK wi:[/ xs8K?`քdvK+dڴb[V>\VRHb1wz CG։->Sq>ҫH?^JϞɀC(kms,$ ҹOrm>7e\ONɌ ɋ³HOjտ)یudKscj+i些]ۻֽV!@f2,QpZ^ё¯+.1;Sb0 .9$J5-_ST'ߍ+@k7SQOcn8hAi >#})G^gW9ɬ7orݨc~IW4{3w4Iv/nZQۭc#j{iGK~P~aj+5,UmS=x7\uij֑<){j v rRwszsszV`\>bwH"9n+S+3(a Ч{5/{=)Z֫GffSპFHugnwHNw}j1lNq=Ǹuq֚&3+P[|9f;"&![TYadzG*T oލXmGfǥjYJZ|hM _j|rxY>1Q]=;V?#S`W|}: Zh7ǰs{'H]>HXz*cokq%DovJ/ |2U&я{WbܼmL)? ;#l2UF"|㊱cg+NZd>>inө}2vBOPX֮rj2(] z _zиeN>jm玔GʻzO(O?/oΫO4dwVcLm2MTB3|ɧ#9ҵFKn{TNh--eWMb2ݺևIr>*@r鍑Њt1CW֧abckBK?UkamTj;<h,ӑV<{1U;&"Į1 }fj/v8@+Q \qtB-?q@vBoEs[ߥR iJus!_@zX!{}.6Q}3YKLڶݹ@k^ Y`hXɵ*nʱo-E9tW|5QeqMxHBW'L>sZ6[ڈ7ZVXwZK7=kTěDӵ˙UC3u:m۝էa\}+{O<J1cmzUӿ>ҮC](ƺ]IڴSo5rn6Le˃߱0k:T~i@Ur^SB(nYL1߽vRQ #aWҀ9(ͻjGi!oq1Vh1W6W22xօ 9C@6|vKuǧ۸M': V8 K7 W^$U\K|ǟX\z朲.7/kqIP~9NFu7-W̲wӱ9UY>"mboxI&Gjja?&,Ey/?&-|50s,m#w8FʭT+ɸUGJ~ nC([qش;ʬܚ羷ӞmmZ6qĮABH+4R1u[gS?ě"0l9Oz˻tqI#\5Ǔp~e۝hqqsx<$*IG[Fͭg[xHWRj0]yJ&ͪ41LWGʂEzG쮍z|/NPS&]SooRxTlj̫DwAFoQ3G~i$f@X![]|EO_gRg,p.ם{gxM_G$vs}ǽu|M%Ŭk%|ߔ`;Y-Qm:qΚPBX}ɹ!uob:x?Kkx=,hL*qО՝HCK˷|K+Gk"\[DDTX}GV~˺Vۇ %,['rqy>+Tlu VY<.N°#s޻漷լmfPLS#%F9 㨯rTϺMF_!ԼW qqjЇ / Q@F1^FomŽLE 0Eou&hc[;܆X6՘d<vx`&DUn'r;5=jq=m>+_^imC CW| jGװ2!1 Z= 3 AY|x!^0I$Ȫ+ SI5$|#ZnOAOScЄc.~!/ǝg+@ۚIng ⽤O'ȌfA䁌p=WYS[c_)9  x`ǩҠu0hc=@Lʑpc愍/  _#? <\W<[(>kccybI#lx ̻ljuWh|>&>far=NVFiGk;MJo!8;N}s׵oS.x}IDK|/ya$=I% tq&CAɛwh瞞2k>9W]0X6Iv@`d]y^_`Q馋{DI+],M xGŊooB>̖bwH4%OS4ļF&Uzlw> zu}@?Z7M*UYw/\9|cxGI[{Ú!cX^RIfv ڞ /B}柣i&.jwu)-lu?怶6*f3R? uoٿDռa]rOxEmrqvk2O- ̿cm6HiᰶV4|YX*| =8]GW^0^8Jomt!o)mp #(#1 ;]BOfmqprTi7m0;Ǒ+2+O-@zv+A}s-VBݹTA4l˴fQ5fu~#ҷt{FmXkt> յ_j{Qwasj|G!sԂqŏ‹;k&mb)MuIX2Xw9,2lȝ7 k%}|Axط{{>#&AH mƗ}ROhw-6CmC=$[vF& ZlDwf.;6`"Hc6c)+?7={MwtW4ZIb`V[5⪪oW=O7I泻Mәg.w39@;5u$vum?? 8-5Z./GI$m$ikDH gN)S^ihZԋC t#œpOO`9}é}Q,= Ii< ,d'sVGۭdžH#% Vv4y_7 |C/GoյOYyI4qɽ Bkv:LK;Y\,4r|? kxVmXԱY&%VY:&-Ddd4OvK][IחX+.XN5<.<"2I9x?ZjNpb}/C[{@e-. P;vbIx ״hR+b =XCv"X$wr2b:uŪY{hܭN-'f< +G9 SK$I4?}Ś}ē~er጖#S\g/Lm~6وl hxB,Oº.}MN6<`goI#p^|qB"xa.g"y:_+7pv\"!YO&'}<!iZsmk5r1\ApC7&=B̀0L΄(e^Yc [(ͮ"ͩtm prP(Q3U1kZ]4ycEnғ9jSQ9-eEq2mM[(Q epa߈`Kx.mxO,o!Hg. #\FSF ݣ !{+\ \ηVj 7]dT>̀3%A=Z}>(iFAL},ɒc_>0.tX4{\ %;YPʅ$8q3_SX ЕPiW u9UCk>;խGUW[Ic\0 ҤTz6ܾt*֘"SVN֙qwq.rn3ީb1օ̘qzߚ4c~QˊbsՌ59IN]!I?v4e.j꿗׎jO5[遞tZM17jZ'N*3f*ťFFjXgiǓӚDp@&k8 j^1ϿCڄ%~ QU!q*/l?1I_Jp)|=j2zP 6V&S٩1Q'7S~ }3֟$<Y(rg=G Y_?gN@wVj7t5͏Z<0#ҥSŕ-LU Ja(˚t(}:X #֬EwƅOR*#D'˴;QU-7~}4`d랴 ᮏ?{}rU;]'-}h5(n-NjHm.p?9BM#1[RM2V׃GibxⶾΨ:7CL1~4X ;+b&_+hf3`)Ca;Wi,*kX6O_ʭdJlHwEIr7鎵3b~\ ۥuiN5̲)Գ#NiHsW(A9cڡnj^*W*nFNӟΡxT.+DxH#3PWqN30~l}*l>lU懓Mho;(sZ6b=?Jc:V?h saH~Uqd[9Z5Yy樉nP0ݗ)Tr2sWœ{}=*Vzjs,@~To^Ij7}ݿZc 1)84m뚩4*#PzqQP駻~4DW*$n٪oScڴ>8ʠ V#mYV/^MX& TI9 H L,vk& 5e&O8[榋GVb77ʬ2WbnI(oœbzU͜=A zu}SdcW%A4[@#9sMNHXN*ݽҀ hI }*/4}4'#4^KG=}1֨I8GtT&9 {UF]vo*i3ҕs0xY-2ibmnQHUFzct b|@q͎֚Т"Xzޏss­E[*gO VЁ5z{6 0\b:zgfUuiͦ1~U6vKdܿZd%J!Ѕ 3Sy {P1wR$sƥwv|*lQPmJED{YdY24?xKSXzLt(÷fG]ޕ<{⭍4F@UXMo|PlqT%l=;Fў Aۏ] r},N鞕7h5;ך[ Fߖ9W[Ny(3ֶ97JVh.F۷X75w{ZzM>{U$I^ߝ 64Ff8܌tk6c>ޕb͋vxivi~̽};Vq;[!ϕ)EmTuL0OFޭiNeMh&JҰ\ cz SWҎ>骯b`)U" 8*Fl`Qi'^Օ3B@U#*iW^b6Lr};X(q/֝7ԫjEjx~sNHr@4axZb)bX =?Z y|ڒ->4js=I׭Sկ?fM,Jr dڶ>({;!*) 3>i9ʢG_Cvx]-=EI'Wi^2n/rZ q{V캽֩\\C*O v)_^*Ki MF%b TkP68X3Mu]M q<@wVX̏k\\pdW'#Z^0ԴW}n:HZ۴ȸQGWҮ%Fol<'8H=JoRf1dȉwZ^&,-mnTɖM5VmJ7ۥ>}zw-m/藭]dd;qEצZ&h A\QsjLsK2!)oJ#)g_2=4krl^k8Ǹ$55vVk9oCh_|K^q[{T0嫛nyd*`l0{V1Zxᳱm>P#gScn K2K'\ X|C5^X|b~R38>4MjZy˅c N/S^u}7úyv$1aߚ3%Lj?6mdoh&u={;巳=%e%qПCָjmvzĆi;9`{gj_Z_ivl(bN}oj7> xWA=^Z$΅Y}Ua_71[Dotz~u𙏋gfK O0\+~3LwQ-f烓YX_S¼OoyVsY!H.7~+ؾ.BjmBa21J ~'>Z_N2E֞& GqkOslc)N3OrjmOS %R۵~g0S@䁖ytQRMl:~ukVY\Lqnx Yv2Jyi}*vxP:~5#>^UJH<}:k0ӒV.Mu3E ϻ~:B SYL!1ƻ.X`t|RVIv3#(_-b\Ҫ%X=Ȭk^+U?1Q&ԼD,PpA%Kw>ÿ^_V63G2ȿ>s9+Hta8Pn*8> 8<#l *yﵫJiۺaG!c\dxR}k>WP[CŠ2fT>iOcF9҄L%ā0xpQ}x9&TcPg8-MO1Jdvθ,-Dx9'"XD׳.%*d:NYV;y2{=jm{`2A\ϥkiFʼ*K{csn#H9'PyeID8Ovݚ= ~!?ߍfx頑?Q%l@($ LYsq>-WQKP߻S7lqT4L(2ܓPӖ_ݫݷ./kk v?jrsi6thƗ|215 a#|xftqѬ~]nj9?x}p?N^xRp:μŏJ^oứ/_-$z6+oE%ڹӞ"NEJxZns{g/>#kG25mF9b)CvsڟC}o-{sov S1~ 8izU-4:2LSٟ+LYZc%/<2 3~RWtj m 8y[ %^Orogb|٥/ /b.n{(";bQ^~nHp'rr.x\;U͘a/|VPc["2o'if_1Ak;xڡ#_*#ˡX$,ɜxkx_G7)bpX8E ߴq + ߆Q-@i:naZNmr\of+`x?{]%oH;,+="yq*dAƄ?~ZH|t+M PEEs ?%rKrVb$'b敕Z-S0u~t~xGӡZ:Fn1s".e eco^8$=MN:4O _\k%=(yfoyjr2k iU ϶ɝhF;ߝK(LdWh:%{$,P[Qt񵸑*!@].=.ح{kc4Sx2I/@im0tȭ?Kxƶ*ik^n 퉼D"Cw5n ޶Z7/lFswi ѲZPB~n@y'&mzK-Zk;{[{sm$Ra,˖ M<Ě]/OK+y}AcnSN!?خ!xcŎCEmr]kZNx.σL3+[] SR]^]mxu#umYn9n WfWj 5ƭ!KY'~(YD &{dW.C.MK]$YxoĒxfXyG"2 8zyŚ^]GŸ_\0;&DrDSIYT\#84v#U:g{o_j:l9mSdڜ\(**F9=*~ |uSQԮ4Of3I z|n%VȕЖ&@I'=+I.-T56@ȬALc$mW-7AHmH\%wAG\yoڒOzƹ!bgͷ ďM^ .HfЗڽڐnnvRGPF611r,tyW^RŽ'FC.GƂ5b;Z"Kx^N֡uAr[Kv\2|T|HTk % ZNDљn>wRgع,3I!0+݋@ͧaYm5*iC4)  t&xmoWQZXs>==\/9+_~ھŚ.,L-KuěsI PJ *.YqE{7쉢$\ڴחFmN[dء 8'n@& QgӾ-ׁ|9}ImiMfh`[8\k&4:^zyk[)bYAb@/Rkg➕qY4]C¯cr;. '$#ג<];]+Z{.ј\Z0 P m;]%4MʹC˲IYN!Fcop>7`|r0tYt(C,s2\ACgd+ܨ YgdWqZZrk{MBKH[yd tY41oeu$ >2D72O̵W:ܛ ["m>;t-Ll}Rx"uPeQE\cV4nLmSGDHXN`R;X+>Ðۜi]Vaog,t>h d ی+Hy.rF w%iD:lisyHmK$H-F3y qV*|,&:rIyj髭A=@π >ݬgx* h:-x_iGo$OFtA,da(pOIx_Q׬--CID~֗Zu$L&IL/*m" n5E䑾҉[B(Q_#&؛b|2qa1 Ko"pbgB٬嶙P9C\Hymz<3xM) b-ɶ7(H@@9x~%ҭa𾩧kʸv I?Y2 FN9M&ᦒ_D4I%TQUN`wgDm:WKAh-cH %cQFVW6d@HϛV0I$+^a5hn56Ҵc7퉉PT+ q]G5zhWZ.EL37۷)A;w.~i4kJ:U6!M\F ?|>Ry_OWcux\7H_0wo%AQ\q~uyyj}ktbli%L3%$]."Ml<唬E lԁlKx>.AtrbO0G#bN 5]CY+ۻ+Y,3On${Qx#k)kyoawPO!P$wH^d?ڡcN+}z y?1$$_>c淦O\49^;jH򛚰"GJֳhV"RwqW|,uBm}vc#zRޕG5Ң{:cKM{ڋ.GyrQڣo54L7;'Eڟ;Ny;3OkMw榆M-j~c߽U1(7S {||VhKxKR"~^+%,wLGGtK`2M<_?&_9Tg\5>eW,w21ɾNҦX2Pɨ;ՠ WGjrr0 槊1{t޾"߽Xzgjc5 0,kDoN泅}ߥhipynzdR*}mtgh޺8>\TOfmHJzHG^j's*kAu?CV!Z: hV-4mgd{Ѽ@y c0gYeڼQ{޴hTbssJǒMT-J͗o9gw|*ۆ>62?˜YzSj26?\h(ݏZwad~nն*ƫ€2 ҠikLr=j/]@L{=OژjhC~T|.^j}o?ZnTBYGUOz;OJi,=qH=qW8==U۟~E$ܻ[4[=DЮ?€["liB ?J𯈟d$6mm W?PJiϕ|7ޯ;!Vͼ*wsΧc,tu Ķj!Hi~~$4z44Zs_YTE| 0<:]Hnl4cxaqUj2Im~g~gG nk^7zV/ߎOl>Tgxo]3t5|;/-cK^p9^/IťJǏj,:5e#HhA91w=7ž7cgc s)bi RYF]OZttqX 75Yba.YR)Zu'hBF_&V<2@ɬM>}7W/-VrgI#rW2]kf^5d[Zx[a"5+jvKxOlX:ƹ&jjm63vZUaݹnI4UinBq f(5;DZLjŷ{)o!R̰{+h»<DŽ>q-G?Ծp8pM}IODY\oo#u<'xDv<꘷LNMyܚ&ƞrT99e+dN~Z;~ЖK׌G̀H80MssJn(QY|M\{8" }z?V_~'o&JuOjp07aZ%FlȪ !@ gh ryoL4mMz7_M|C s_ hf`ܰ#71'j]X߂.,-b-SO%^PPHU !,H8ߏ4 gMf{ ԯ~LL,et  ֐x#~xQ:o}60r#a B $^{kPJ', e4Y*^"7:cogƱ]MNKou2B!Ka A=~[+_< {X.IVh#['dm>f8*>+-׼?<#b{<!FکҬ]ACټj\EΩٵc{gjTO$U\0Kr+Dj|# rE;JGo7"6@PI.yȯO^7+MΗv6bo9'魥6y%jzr -( ŎGqtox =juix/ccR1z*%fZ xA촫&C4lIB`#e\>s0iڕ&~ Q(ttpvbߖ?[DHHm;=[^KhBWP*#$Xխn5;ɤbkk{ F` ؉H.o 6`p:aNv>7c,rn]c*YnbH0|3moچ$Qju턶ڢt2>kIpA!Q`xsg,W[Bj\G% jn\,k o/xV{]A,;bBUYJxʒɶ@bijix"֖E/ X`yZctlCGCּ-agmokel[JD$ GE,o ogŭa.Vo\[y#-ޣ>g;e.{\nT+%,+K`b=895{RVik[mn8إ) C02"/ơͽ/WUK&\;O79ARƥwrn!!BCY},Lz +_m^οj׍,wz|peC-ͳC9QKKc;]CM-KiM[R̸, )\w<ڌÍY-4-+dcm{c4) jZu2p%R4chrVRByKi~,[obSB& 井r弇{,XӭZ=U%%`*I%;Tc<\ޥ[A-Y;Y>n(c |߀b(uTm#]i!W"[n젼b&͉f/270rcJ?w:\Z, ae{%y2 uE0$lAZRKku *yrƖo2-2kGh]ZuY-t(_B_%Ç|=:Qԫ_$V}:YHJw_rH%j|BS+{ _q-ݾcva)ڡ.20 |(4|@ԚêAFR3a4Ek4ҵk-P]j̸mM* )_P4|5'uO u;Rԡӧp̎>A "_ϖ'zՍȱkaw;mS&²ȥ7n_$(-ܳ\H$-+if>xC^7.#Pw-Ph.X1I偍 qQ5SNOj˨5[.l̶bktG;I2zC?9[eKq+aBXV5qk%w vyb8>aָ"I뫭=i.":31g->cƖy~o\^G. p~Vz @u X&A7|E dR@a17Eᨾ̷Ȓ&8x-՞tn C37l *^,ŖB98uZNVџZI3 ڽ5%FkKl;$D-qo$|;r?HSP9\wɧ&U±\s֦ 4YnjYpUHEXq֨$`#MJӚOퟭ^=)@j\3uS}h/& wT^v-^$9n8247OHqzSbޕr,y8CD vӣ}<4?Nkn5 h+Ҧt%yTzhx^ GͺΕJ~Q5^cϯ6BpՇrzk[ˑSv9*V*b-Zpϯ&znh>aY:' smP~> ehNI"Lf*?z mA(U=6bMGu2)\|1PIzJw*&F|ɞzU[kƟ ZYtC\E8JԷPb{l'|tj!|玵ˈۧoJL~5nVvڣY2y.=*XT?/zu=1lQ-ӠWEІdcAk%)?/nEt~Qm|5_Q?lg,GSJk{?ZJ{V%\ƜeTʹ/z14g:#z "gN}(%hݚ~`*G|qrIڀ&w9VTsR/Ӛ &31hc9%}093Xο:PpHv[ڭ[˻Q3yoe @rUQUWi/8怱q$SK Y->_<RǸ3T.?~Z[CAszaÎђNwd~r x_;9mRc뎕;04oaS{j'swWBBi ޑ-aϿִJɬ K=ǵtZFN$ck9s4(0K`Bt>4!ޠi)8ZtԳa>*3[m 3>=3K`\ySZEXJ+Nnu^ϵVefU89?SR<cZ%'_΀nF F1۳֧C 9ϭ;u+o`_`kX%fFzueJkit#LI iؙ4~6u7W1:;1zo[rJZԮ2P}jnyu6$wbpD{ߘܣs&]IbfDU_OkԾ i a+fC~|<&y,.ߔg9Dg亵Xe˻8W.f5Yi7C7'0װ;x,<&e?zGxWut]B3Y.5Ӽ4[ӡV?nml+-D^"rzҋFI}ZKfāS 9=yu/,#jOek6uy!'gg]~^:׼Ej5%hXL N@W7ֶ󮘨j<WMOPCLexdTv|i??)v7qf0++[yo6LGQW|^T~/+Z<ֶ7.JLFp{P;YM:I$=@{s]?MMp$ʡPOOҾsJTZ|WNU#ɘF{5{k/BKqsbW^T[gվ__~ɷqe*:}^ao&V5,}E|#m~ { [kxrouG EkAdxn'8m顜;㶌)[{ Dv?Ş߇xk ծ4ˉeY%,v9Fj/Ug +qQ"#N0|dž=i`Oh࿎=^v8{F1;qcXdMF~S=61ͻOmkZUm =d VPTuOِIR08 }jC &&0BCHtvxѬn|>Uk ~rxVՊoE lF}6NzxhzG$5Yql3,b/UPYdN!ݿQt鴿~wo\.Ib1d --Im6W(.d25ʂۘ\Sh1On!Ig-&Cnld8߰?k@xoYElA"^<\?'.7en#>Ž`?2Dw'U}{OYf1ȀJH cq;ҿ\5/iZ#smY>\zu@%&ea^E\9<#Gw EWCh"\2rKr TJʳ.$oaL^hܧGR+t%.v 9* 3PE]tTlj~FBIY"dr;]͙*CoC|(P98/4eUVUޱ|OSg]#O ;g֝68 Ō 6GG9|;lVBȲl9'?aL%AqX>  t>r|.7r.[ {vZaۙIWrqrYʰ۴9 zV6{4jƣr﷾{UϔɿuRGDbry6%>Y ZƗ1%Ąq r{'^{[vre n=AN3ះ42ab5db g=v&kyV v+ڛjv]Aa[VnBاћ9-+Ӵ= Gk۲^{>gt"a1.#u[@U\eoKƓqM;K,"1{+᷃/ubds4vyE8|-YzڪC\Du!U _MOSU>?3>UufoDjdW<_/`.Lj$|D?oǫӥXW2nhV"5;ʐflayPkf_y—lcL?̞[H"9g+q4wQN$Rfۑ$qnܥ#6W*-Ѡe[hm 0yRY81It{|Whw {A.OXsSϽR!,Hby$1up65 sۭKJ){FD\NpħO/vݸlqqJ|ά=RIt= >6fua.uo6nh㸄g*k'?.>x@FM%<`,r&B v7-OO}MW0\%Ֆ뵤%fY&RdM]RtXo#%AٲI;vU\3=hǗCOP/'ǮxNnM|kk@KxWg@yCH ݁T> ]w^k "9fFya.Ky.^_:TlE?3qj,Xy(Csk;"H.,rPQU5;Q,--b3Zf%s0K0QbODZxnS5 cLBԊ-)p3+{q?\&O 2C1'#=iA ,٪E뷷h~ͳj#xPs$׭j^ 𿄬.Fy.eU\À:b[| oxiZo&ҼM#Z,5MG@ko iα]CjWHmY>\E!ݺM˾V;J 3\LJ-iIg 5MDfn639FQU>[ 0浟._ ^]ɅtV3oj ]drdt3sz^h%mB+K^OH-InWl&3~N橬|EMmkI LJn-6[Դ-<7uխiLvĈZY[s5 M!>&~њXtThd S͊%`i':xooBjZ#-S=C13`]߳.\4u:)yc9Fx*7ɐ L,.a#CG!sxJ6ZyԮ5Wr'u] hϚꚮCT 6 *`ϘJ|gm6j[)կD-42D;(8ڣ'i|FF%vD$3 _Fw᫆FMB-w KJUeTpHr0*|tg~#M}xG2ogqyq?x~VQ3nv8[]j-^A#{4q[R8.PY:h|Yk[oͬ^=f`0Q :yD#K'񆓤֖LyAi x#'!2Np}O&iLv7B {ح nLqfr0R͵X&0 r؝;kiwh:v$r^ɶi(Xe8A#kiGk^jx,$U[ h㏠5 Ю(--bɊGή' Br OB ؾ.,#ջ{H{C+H<ੵ_lCbcB/xNB[d_j"]V#ynKAK$`IQv׈xZt=ݼ1k}~xzO8$d6+sPA: ^e5fݽWd WǗq"b`S~)קyyWIkdu3=o/0 aJDŽGkyX!emm[S1&E?7O=A/]xongحBX慰Lr͐$y޻QͦƟ uxEWrX{YY<`Fj uRkc.:=ʪn>aK#eE oQ\|)=uO>$X-G [,˶]] 8M$Z|gr!25RTȻ ȟ7\9"f妗c jy=ŦFwȮP.oFpqQŘԴROi$)mi7 qljѻYjo|Al|f>bM'6`|A{ -^771h }NUA6YLmm G/R5ɤim]j.mek漹 ӤQ8$\\:z匆O$Zmq3ʧ039\:0C|]/]γo}RC .mWnadpci`c@Ĩ$1 FӼ'dȰJH(x], 4 AM M_zNᛨ>c#AieV59F ɸ EGk+v hLhѦoRN5G.jGh3;>ıf5 ¿./+[}(Y-h흠"@$f+0(XeiVKyuk7xVj3w=yRȠ6V'RD#*,Ez> |IE =ym BD hUH.'s⇀CWFk^i6ϐ],IT,{AENEmxOp Y ]Z[G4Ztq̳{?xbYvm > g6RC]M-KOho4D&03'A oIyðjv V{ LFpk A㜮t<'5-[;Tll dV #RaxEpII\-7Z'(L;JgvA;O]c[auqM2Ϳt#{p *@xf5nռU dͦ4:~`iO IT ( -Wm /x^ۍsrз ?$ Mӻ~J1~P xL>5ʳ[¬<3A/Q~)xwßlԮ+l̢KkVTJ\CLt5.[E+UCVe)@l*p (celeཅj|+yubo$1iR1dns1G_[ëIRksx)rϹ؃*4+Ém_j;wLVH!bRU0uA [b(MjyJ'@ Iǩ`9uV^\9...V%c֨YHVŹ%7_T<6W6ߍPcY1'Smg_۹pZ ?z֞cj%FƓ~\]FlB4{|IR}88vJP f48RiUZp 6Y),Y_ccdZ(/|+Ba'ˍv^=ːHOdI ô޵">9)#x.}sNq:5ZubqPTHwsb,yUXHSf{wRE_t4c@MH_.? 2hlB)\ V*G.)Q֘1犚5RqI ?XUƒ߭[R}#?@)Ȃ>O~?C# a~BAtDF =._ʀE$}nSYo͓H0?(CPI^Xz֦X||TlPL֡\cX}Q(*cJi61$cWsRh^I\Vzgիb{+)tb)ץŏS)"[F1;{-”hqPGz+Z"mަ .2 ޘ"*,7~t6>D$!)@8+O _w<;xvźCOo44۟S^Eobt6}TR]PLh=*/LN;"3R1$ xV-jpϜ,R}z2ڲ}z~ɮXC$?8sޕ?6Wi/ܹPrARZ-Q64]U/Ztd+85!#'Ұn`]% ưt,N;$ge?BeǸ]Ky=FˈwjF~9=/ָhǿ{Ӡ6\P0?yjJoҞ ޘ]s8leV*? k^QyH/,z.wp5b yoOc@Jl/NQt"FMEn3(I7)SWāq\iB;kKIq:U!84rvPg=iia]6Ty{%E_H>5s O'n]}NՃ௄kItae;|b=ox'U Sberqxϧz9zօK[Y-swq87G'4eD2ǯ5ϨxIev&K0G=KJ-cq$LH꿾G#޴n3@KdPN>u;Q[;+s+/=swyKY4SRk4JO9#^i.^YT@Gʣ'9zcEeSxjt|o'K;%Q'^QZma VQ[;3eF`$RCkꚌ>bn6 9Ϯi\viq4ʡ?szuYn/%su!fp1r:rJ|w  B?j?]Ks'Td=^UX qy Hw0UmJ|Ia#\[7I{:T9ּ7au%,m8rNk5֏;u-,s!}[N4LN֗5ͣoo zؚRCrB2RqҽKOIȿ4rͽ3rxV)+U1z{ ?Ue B`[{IXlyw]JX\GP?El%񦟯|`ۭFo9 w_jmq m(2Kzhx9m5ߴ$HC oj$ :=?WǛ _jH{P9UgwDOmjimmN#ӊ5<`SZyw^-5ɧx4HcA MLqRBrmZROԙ~vJQ[滭9-mhŧG=sОk|'4حGT4ij\} ']=6wH,Xq]Xjv-ᫍsK XE*A ǜ绞-$:~;,k ^!4SvЄ(z:i[į^O~g퓢M{oj5QGܠd$9r~͟G²F ԇpOPO+6ʪHپ`ycb?fI?nF:px*Or[nd!r#gcOJnȒU@'#\Ko/rst]ve&}Z;3-4kmbn$l"L/SGqUs9ݒdR\[ T3"fl;c_xՖte>Kt( t$H~$xG-–D7UJ Jkuy]MX:odT6=\]'&rѣ{EF|<՟\]F#ԍ{ ]λ ef*CmIpk:njIIB;!fݹe cnտ ׼#||ZHFp^kDR(mXm} tu}B Okl/>mϧ!2@I<VfWRWgNȋŸ8K=ծC9o<{i$W+1~͂IFRA_ZEǯ];Xܬs_@I 1F( ַ|τpL'iZ68q#jQ2^[]25{_/q__mA@6\y qKxVXAgghoV(ş^TWBDJx G-%fDex_gL)@^u#x<5ux,+!2 c#qK0 4Bh5"]r叺NхQ%?F{t&}B8[]rA$ c|/ca^j3kZ5]Hf21#MYw-?Zv'ů!1 v1u, 8c#A>⫽gJ⍮-nS1@| F:ES53WMGF\wWSjoqce.:y D"J7yfbg*{veNJ<Eͼ=A:w~mb WNWݿڤݚ4wI57gP6n@S^/"HV՞uجKd"0A*,o[[+6w2 Av̊NߒF)sM4 TfYlKUel!g0xz׀y-( |;>QWmFմ}ךw&֌OҼܱo.fUˮC @|u eٍr'G+[,bHG2x@ۋ=OAhshwZgLҩC!Kªm6\V_ ܋sm4+_EomW'Lܱl=g_ k>Nt[/L1ѭGx㸍E, U~x➉K^Zwc-ż̑$-;sp|߄~!?VĖriaևKќYHmDXyݵ6?w6ojfZ߹X(>G&@w(ve\GōJyN-"ח%[hdi]wnzTg*W>[ ~!oh: \Amum%R6Fv+KaJU5bGⷴowgI|K, D7uU|s ?AM/ÿz}+X/" Np;c1>ώ]&MJv>{s{cIfb`&-ɺDHty%TJ#GxgX]^%爬.7%Vݣ[#YZB2 Apk>xj|>LKԡYlH섎D`1`͑~Z&MCþ4M. MNm%UPŕwů]joFr?÷oA ƽy w4Yxȩ#ֵ|IK?h;֙f(] n@˸JN ${dUm".Զ:JZ2FP[KȓO5ctZ}ͮFfIt)0 Ck#t$l!KԴoŧZ ʄcw#&Ud\T\tKk]sVB$%.F_-@ Q5V^t5u a_uTcX*"n@qIhdr.|W{Ys:tn-u-ԒN9kXTg;[ ^et`lɧh|>آ*[;s/qkPT干O&nB\B!`ae-HM}ٖV3(Dy8_-؀CtQHYy}TK}.IPOi&2#"_52$}SėjuM/Onn,a{# ),qC-3yRpE.`bVogGkgqOUkx&x-.<ܪ74>)~оk2^i&uDym4Ka{qH O/^^=Zٝa /62S:I1G29x>PfQ-On_n ֒nH˳Ɍ.G\}{KGD*0цګo)>x ji\ot$\;Nasq/n4t.S)6OHWb YF\2{S)hK[4bOe̻!Pr sq-ż-z޶'K\*+\+7ch,5kM‘Y3\lXJ4L+6kqK5D2ۉTI%#x?#aŘ3$D #Py*I`S1gVռ[ZIIXd1fd Wf f𵿆̯g-XHҍ6uAlᄞ?[LM(Wfe$39sT j.v-.m(Jd]"ۚE~w}j0jWVsgXt-nҤ FFJF08&OZ Qǒ7Ai'ھ"YmD2|t|!"EnȱXpy^6|G5xr֍FC!,G||q֤,>`ۆxR,[s@\ɰq+]VF^*%[@ *caJk2㡬._[IGUox?0Ұ4;wo^sޙ->aG0'o҇`$wzUio3⢺fϽU̬X>Ƒޕ,[橒/9lgzhQn~jrۯsS-ӸlaSVf ~iˌvJd)Q^&U{J=˳ީ$ld?ZaULnYݘ펕.~ zds4oh+wc?9U(cUr}yPS^>яg hWvKueQ+8}61tr>ր ݤ|ZT:U=Cj8ޞz߅5d1*7XMs@n}x눛nJMJu>IҀ*=⛽}*Lƙ$y"}"C-)r2;ԏhPQ'*h3TٛARw=)qqUerTzr-W0#ڱ#Y6NX7ך`6⎟Z }uG-;yj9%Cndfʲm&Pv܁Ҿ-ގ`Kϊz~Ƿ^+D9E]܊ʼٛ{%c9MOl aNqUQ>ێTƿz=YqӭfOQҴidX:Qw`:רjZ3n+Å#VEe^sOFjҟGh#ހ"G  =8Hc8^hv~@=UaӽVx5SM$p()3%';q+ޮ}%v) mǀjOe}F+N?œc:+]PÀ3R5e1׭=iCmn{s<.zA~iE5n;|L$X[f=7KU휜sZvnҥ0[&"V }cQ&;B-MӚغ ;V[q ;PyJ8h1hH]ޕ"@TΕS=zfo7&:\{pATfV !7Pl? UnzUˎ#1eڿ0UdULܙYt.̛UC|2|͎kF }k6{f+; ftL/Z!y[qu٣?ĽA(''6F棍 }qR*MN@u}mdڧ okf{?*z55-Ys^yJ^YJʣ> er:֔ɑ E{ҷ)]9Xbap}Tu"]d ͭ[Xk^P>hЬ?^zw:? WIkkSi.~0!S=܊^ uCEI~RV IiT|Y4:5rhѩ{2t<zύzShl>[]˰,y X4H&0.໱}kmƉ6[c;<+|wjw} Uew랾Wj֗ia#j -i&h^N=??@<ƾk]X̞S6#y?JV/0< 皆ŐhжnBǾ?Z<x_&]7*sE( 7KUi-Q|oVҽ@u U Xf@^ORwbYT)gnRe]ņs)6qMkuy̥Aqt *m.87\q$im3Lz?t;Xq3Oc5Rq*Wm뀳}`B8=xpåq%hחr 6r'鶽3ޟt˴H#S׃ExLֱ[Imb_)3\Np=ꊊ1].y,/AxY9(M?TcvtvK؃Go"%~mv*׺okj k ғ0폔~c$ioFFԖ-<+# nq^O:w\Gm98Z:=ͤpnַDE o\׵t7o5Kwa C)=>ՙƝjڍڭX$dYyx-6M%Ɯ>;66q4ͦ^4nLJ1Y"<5E'ڙv<㑓oz4lWO-n DM"7Q^8hz6wu)V 6|<&dVk$*s|C}{_0!)a<*Ē#]Xڗۼc9>/u_, kA:ΐK'Ol=Eƌ =$G뎍J xXRd4qyLjx$m94&^ɥC47i'iF<+| <}&hMiS̟R OsUH?m]3Ao.4P$٥[ܕ:@Z5WtW#eti:w"P "媤gb|cE;-,JG7 +n݀àjz :jmYOIэ=!1^5$o$u?^7o4zcIG4d(>U%&x0޼0IU3 tkេ-<1afO,[daU>S*~_L3-S3=5aZKrJ6&Ӝr05Nno,f2MdPJI>&Hq"o ڢsb'ZVf g(+N=26Rnះ6ڵ*O;f.V4DVf'qNkAn ao38Is47uitxpF^&rZHٕ f;bll]Nnu ],Ce祤&)'t +myԮ8 hQOۖ]k[{f&r!z-vַK-ط!F0©~l7+ۯxkKMp~@pd`s2xr@qhKBn5($oI-Zibdr9 E(vw*S`6| >0K.cJӵ*WiyfeوV}p:.[)8i%/𝅍dE/dhVQH'%eFbX̘`.4NSׇ:̲^I+C]ĈE c(U ;h9[Ooi]o LJ⻑UL%Hg!WHӵi"٭} B&0iGkaJԼ/`v4uRŌ,߽w2\^?j? /+CuFx1[Q&$#Sm-nPIx⏋qVnk .ʻW;}BF.ݰS#oí^Lc2l.uGD-.r'|:pZ2k-ܦKd'o0 |kԾZfYE`#)I%!O9DuLcm'Ãڦ z\(h.݅~^[2*Hdh A*A澚_/|qjd常1SrNmpA_jZjG_Z^Yy ̩١$)7S^ ߈>2SVpY_nf n-aO5Fv~$}>(nS -mԴkF]q O:%|ZUb;HPkkš 'Ri?[|,6e#E%̨TP9<~3j^P?ٯuzWr>#yWiϨx }OOkűXu(/m]n{yPN\ab7܇ا=Kk$PmgAԮbTb`YfeY͒eRJO}]GԭV uOԶ+y*кr| ./|N[{H͵ėoq`WE #\HU'T?&vNGfo.b$>rʖ`(mS®D=Z_鷎ڨI]1;~оkw"v2 K*ʼn*fUh/ɥz- L/<_!Sȫkf 5߇IAjR]D2ЂԤ`G;.چjkވIm+Țڤ,^J#Л=}B(-qnt]6W$c-,2Lwe( '+YuMnPg6aO6dBarac&u+Oo PäȞk_yVe_~UHؒpz2凄ub5=?^% ]6rH~H9cݙ\یraxv ëquVdZbLJۙI$ȇqaҲl|GoZ|:4R-lm VInT|ϐfpQŋ6i+ vɥz, R"#$¨g!t?Ʊ%⿇nX%2IbCJX/ˁO0].4yR}-$ !cPʼn$ѼEpE'Z])V!Ϝ݃ ƌ݂vO \ڒC5Q#ydX!'aA=}$u=Vvm.<2.|pLE>'Z#K;Yb@jHW\U\7Vn&&f.jXPsr: ڵo]i2I"c̐Hy>f$(8##FwZm Xa}Tc+BU}_#:s~IeY47R6V.6s 9CcuW7V[ꑱWKw0$t3\<=w]K[vSJ9.r2N0~QHFkt.1#Lǚe=r:Prϻx?Aa]9okךugu3I忙ɵJn;v-[OK! }J[=?*=F3qi>Ď(v9HO Sv0s-w)i&vrMO/bU4)/*__5n}޵^}1Nt:ŬULuS)ݥwScpxu! b00?.ajoLɶ5ȷT{S[ƥ^=sU.Sk2|M-dC/<;/hn:!do.{sOSMI{Vljy\,K|F{ ?G"~o9m}WVr.}:u B2}z9uqTfy~y!]_Ok[7/˜+.&fog]|Ⱦ/St(ݣ IZqq[ s&kSJov@&v[ bBW4I ~R.n{M(3iǥsG{)7G;>8n(=ҥٔ i! F.{ԊY-TW>^~挠WKq}ò)u!|J*Fol.u擕cfzW[ *~j6ojW,:/SLDտwͅ?7JTA\2}܊_N)c-1&Jh~ zg:y-Uȉ{ח ր%.{SoX q-fr r'橾ݚ\rP9J[n(?Olf0oI N7Y+SB_rjjs SSڡ}D{>lsb78Vycw֯Zj^`ߝ>aXRnݏlӾ_ұσVyO\H>ecޫA;\ {Ux }h4+қ"گj|ZtWDy=\-2rج(}Q95O\޷򒦲nI!N:4Q;Ց )<HORǪyH{ȍfD\n!fG0rs_8js(aC^XYuڹj9ř¹>מ՚ЋT&Ő{{ցd[4i#SiIOEq2Ӯ+}ӎ՟y$cwjkqW)3nz]\FXmoeVЫi VdJ4㍿giE;'^pAԕ/]%l;W >@ɀJ֩Ŗ' Tڧ?g#}ỾjM;Q1j6i,Z1q)l΄Z.HJܩ_`t5VH$SК{ɥvPI2–[FmQUt(<)j$|wSm8cUFJ Z~e$ǧ_0~>>[[54 t_pYfqc VXlnnVcZZX>x6}nCmc}iuŜH\\4%]e޵ki<_G#ٸOƞ">YB>`*P}};["met b^?Z=M[W&Xads|{ֶ^fʣ4`$JGZ;94K-.!ךW^ hm1r] ;uD΅L0sxE4Uq;y>h-PKI63nϾ?  -DOʪ;WQ2h<1. ԟxMo! Zf4N#ނ#PgmTdj"cY*2$N)kf .ҷ~kW6lk8㸄 7̓HGSCO~XaiiHp= Ky"u$h+/,}3^eq1Z%[G$(y?<A? $w2d ŝ/_X%Ǔ + y9 m!l|?q!cdE'kuui}Ǖ8k7OzKmIn$)Os37ù:-vi_gXn' y: 6^曧+uXQ6>gs/6ƨ[I5A`3t6mModDHi}9:umGVb%ϩs)ePlL Has/㖫ckM maotƇ8ڧ=W%:ᯈmV s.]@p]*?|=}|2]viCj:2Y[+޼=m_G3Y5}CGeU%1$"#hSX{Ul78 1g=/GU2B$2b`3;p^] ^5pc:z Jf7lY훏l#uՀc9ZYryh }=z0?Ku֟ȕ$t<<_+Z)sC.ۄ|< Gl2G;My13ee1Zhev8}3ڴ,k:=&wIGoQ\sId `bF=+͒@neCe>w5o%[h9Q:Yqv/F\tX=,LGoӷҼZ웼;|O1tt; M6dB>㟯JOu([?N;rk.Ui# T/]ElR{Po?. w- H˻XMKٰ ?@{VDd4}>~0N1+Ҿ0oYå[hl$i#H:zů7J!cyTtq}z3d5 {mKy6Aa0υV;w =]O୾Iëf3b">x۱BUw,ʁ^h/T:gϳCq0G i4g1GM}dpIbq ߌ8qayw]wzLC[PH>oN (€8Tq_})F1v?2IF?|Kucamu<1{d°R@<k5]ݦjn+aͳ!FHo$#ei~$֖AaY'QQ*w>8]^@84-?^WXc-[֟w2ۉx"bOk A)|]wM_xoj E,Qm%ѵ[t-htXS8tsXK+%n4+Ze(عe 9 k-~4ymlu}^@\$ cuח^#{]Cti ҤUtG=Eᜉ2 `^N~n5k3[!WyvLV ̊clŇM[jOxwF4ow6Z~'Xb\;EPɬgx}CYҠIh4aUU(FU W[kʼnⷼ]{Gy5ɜ.nefD d7 7&7s㵁GXAz|nuޤ'̞ByQ/^ k/c]rY/<1K;c'Eh|~3lJ ӋhK@|فɸ%f/ K T%M UeNT`|߉-:wkWKw6=#43H杢2qs&L+ּGejuGR;ոP/6BVF*μ`J^;cco!Jsxy9?> xoǗسG)[e gh F0#$6q;sm>2j")v`2K*z)₏BuR:16M\93gLr&A7NkɠK-O(PdY0&b$W=Dռv>ռdk,oU< w橩A"EPl2`8UU,}y,v>Ic[jŬ^d$l9gcx+ķzLڬ~/.-!+ptq'>74.KR4{/ڬ[QeY"m@F9?)-^c76?kkI3b$ԙ! |q.wsMcRXEqkrvظ-Q@͑ O6&=?FůTVv[62,2 qckn_.kak`^M2w>hǧ%mX}#Z,n$f݀hV=CRX0öFkɰ]$!shLvk QMVw-zYpwq[ S3d. 0&S ^Oijk~+ RdwSa9#v'fe'=yρSR4[GѼٿ4Kq#J<һe+2`kOF0ˣI[[<6mL  H,z)%G&@<%,Ж/#Oԅ"7HW[G6zZ-z 73,Pg_!HP$iT~[:% ;p c:4iQ89?hj f5O &OAŒ>~$b,0B7*j+6RMjz<6/ִ7}!FEࢷ$nepA>_*o}md÷oy(v%h-qƺ6jq0]i"D[n!F<c"Ood춉#h' V(+) tiu-Z+[m5KdIq NI4\xޣi:]Ye0!K2&B|W2G$t o [Y?Ɨca=^=/kf̑o/r@<DcՎOMMz4zNYCk6#{9] ΅1@GBinOԄV4?ccČFsXxVSC|B&),v̲.Pv)6iVŝqpOksg M,3M22qҴOC.ǃ<}47wmY; דC,i[@6Lk!Bźm֑r4IO`F!ԣB<{Ley䑁qۮ9$$_ff!IF'Ne|@Hn5Ei5(-u,r Z&|9v,m3cK0GHfF7Bg7 D2r]xEU4[=BM t4F$j^4BsYdasMXl? MI: 82ǘ{+U+^Z}Ԟ!Gݤ/Pþ dZeݍosm%iZ又|i^jzDj1=`P1V +E?Iư]Z s=!֌o8@1%R [i3ro+<(آ,<_:T2py1+ֵ(|>{GwocU 9X!|*]Io皞;5M:źN=>(,0rFt Я,Tϱ1\<29[|@H$bYgNLfյ o+Cf"3g*$9[ 0˛kCd-͞18⿉k q2jr 9Sv=F@_aRi ,ΣJirݸ Fsi~2f%#?xyᴅ}0FԔ/To *.d(F$I;NNj? }Ep֝xoXf;|K5ڡco-DyHj:L$ק~ *$,|f#8(ٷĖ|0āa;e9Ru;NiXY m<:W7!Yݥa0qojMovڵ 4,cm:=7iYGmNV#ENwnN X;]aޜc y:V\44y_yš ivBiJ煨+ maPϠIgJܯn⡟DAG(0[u/*ŵīj)<' &1VӮCcxSG! ^xAP>CcX)bE+]&4wI~\\ |:? ~]λ#R芧/N(arSHx3I*Ҷ?0Nzis9X\n:}jGp:z`sWSUf.?Qqhۇҡmߗ֡K"kj@45ZGkBF(ZѸszbxGnWp-?tzg!T\(|MgxXTq1Cj$h_n]GA'ҿzjTƷoκ)Fx|i]6Aڛ ֥2{d<{X=B>$j5|ulT,W4_MQV=nB6ǥh?zbMx_hڹKv^r6XH|u]+/~k(lZ~2qه֗(Ϩl}|^/o"BkЬkv9"O5Sۿ{Tqh}=Y{|Ԍw j/9p}ln Rs] 7^3y@ ;>Uot *j?&ڽrsMݰ4y(MUvXՆ;϶G {ſ%ݜ[IAS@XqU.4w~`Sta^+ntc9juܾ𴋡(c8|3j巅n:}+]F֝5zQs8r5g싴 *>ŇQtz?QU[MV-6 |w:R{lV{4gHNAGv>(޻hr:qAR6r8#>bfv~O.Gv`GOBh\LUio>jٮ~mJMAQ~\ɮ4G6vޠs}mfY[֬Z&lNzJ`4]Ӛqg+Nř9WcDqzAcuw2i GN jާ#_yg;WM1~^+n~\/gv=yJ8iBۊ-y]h++e"h+dמJ7+YxG}ZtCUbToI'uR/OU pb1&.CR[i8a޺&XzX4,t8*{/J( k^%OYW|h=tEҤM9I.qW0OS@t*@sh֥!s^s2'57GEݰpoHo'7rMmN1Kht^"オ.z>2Ԛhmfأ6pzψX|u6W\ƯyGo&;E]y7u?-^dzk Oj Y9wI0:on 'Vd̒,?f_.oo-c{&!h$hUD\F|Aݧ3&p&90 <?y {2)N޻6o@g@ 7ǗxKyT[]!3V'cm9= IˌAW$񾱦DB2ɸu W'u[HٓlN]W)oivƲ`g4l/츀H@簮$~oxçDT\`{j<3'u.n)EaZn!M=8Yؾ?^F)_BEtN&O+&F$zwWYkuu21nJaiX[C.7(?^ֿO 5\2KHuA> QW 2>[n9:zdj[3|Ls3q&akm%i06s߽Mu\/Lk{W IEs5.u"&±_ G UY'<:犎WKaIfUG8SYjmރ$0B"b?JNݾwypga~tS ?< (>^>Vu/.!ҭ._x,$<)oe.pm;6C:wM_fh\DDg$֤\KPk=lPک1\zZ5COXyp墓<qZ7߁4[ˋWn9ZQE0hL.ՔハʀV-MI5!#`ryY=WN//GK=>¶}?:'m./lcH٧ITy_֤~חʱ '@ ySpsuqy&ᐏq2|J$r2q^cOO.f; 5*-vL=I׭xY۫iux-r8诎x'~&x2M,/0BH0 , !ךE-f-COqt;8bC$vLa'þ΁kֶw,I$0 n6@8MyW93u}`Z^1il6H.q_~?PI9~]G<yguM.F6 1y]'kZ:>˨iܓEyn:u ko7RxA|90f^I'e%QW%7ۖNCZoS3|Wa}k}4mynUm/{Wܾ VKyfm z<\?h+ylVsZ¦?~~~>^ַ 4/&Bgf8_g+2bK5ma-k2eQc? v[+w3zc}5YŬn o^WX[Ǩ^\\,#$=kǔϤ5%XQV,lǽQ=9Sx 6( ps^mfg ǀuD65实m?wzf67?o0\ #n$*dGE4tUdȓ6IUTeP$-~GO?aj:<_m%M۫jaWz"eWzBI Hj!x}uAq57#2+N|C_KcPg[ u0dldVWl]Z4@*DʖJɽ02dwW'&Y- [oIdtu, Ǘ*FT;?*ӼQy }Ci<;=MyaV8wH(9eWF7٦sᴹʳIepFnn8?9xt[4\\LɗZD(ߺG@S5k;5Y#$cp&CUk%CCzs_^Afi.-Ċ<_)TB$GfK?7חoi><+Xn `P޼PGUZma\IlV+̑#$F;N3H[W:} Ek-JRd$Iz-H74@㳶wbeb :>']ZxwPCĿebel܃=7?w&ϊbðu7P4euB&I|y*?4uoMk-ouqJamq$|7I"͡_x}ͥVme[x\$o5C4 xOX ͥi5Սi=r-T߷sZ-ö6BicDq5؁Ò(QǘfMb[ԡ|Ew{!쿻30|RVA1`ORO;~ۈ&-60\U@^M6~ہohwŷIu}.vc7DP2C1hH h}M3̰$j7 BH啁 A5h,%ELGP|dۓG>61}(! 1hapXIěs_nA5厣dB#k-f2и$\׃dkc}YcF1\7($H 示Y4}Y4t[3ϑT+Imјuc=οc3 G/V/YAY#Śߎs4s$ٷtBe{V\nndxK麋C^Nג ۵ѡ Fx,rwtxz[_nN+gUbW iF6F$Qizֵ{)WIZV})in[6Fca#rIs^\Uֵˍ*DYy0HȶIIWh\"T^Dj^4֢=|Cۻak V(s Cg"O9;^~9ɩ[k7ZC ˄E… hMyƣXK.@PUc͓@Znk |m㏉:>kya5BZ#&um<s,dQ𗀴=[\h0Ejj`pFK8?2 uxIko D|& !KfވziUuj1ObIl5+q#o k3DU<~$S@Sm0{gBE+ D"mxVky<3˦E!ZD,ZRutp3/04~4߇SakO>ZIMJkx@ G__k5_zn6K6㱎y!(0 '9khZuݾg&Eؚ+bh:&rƈWӿ_| n-vz}ċ7n^rBJX,ʌ^m4,OCo, dh,ݦ\<o4dpZ'Լ;mm v,e@қv򣐸gRvA vG5㏈/QCxu-:mF]+BdXkkZa&rA\0A8UkƐiݭK>m}ha'ʂv:D0$cx̭5zl0ϥMk[XMR@~ҰL|o-SxgXK{Ԡ],QbVP;*JL*%]~f5E.He1W a+85&g??o.RcwD?{q V݌ïj9lo}{Mhcmm @0I*z5/|_5žg,VZ.d H##_x^\hzCzl 1٪(G6ƙ݌US\>$IeIyEd*\2.@`i"I_H64 l`v)$Y'̸T_s 'Ln-/{srtq%h 8HT;8A=*cz[XԵmG oصv\F7)H HWZGG[_6JRFte gLB1p:inY෿Y:h<d̤NH?15>fkkkOippEdI3y-hnkSHRrĚrǧ'k椎fu=2k#+gkg7%C˚HeU .>oUF>Rխi Gcqn[vb|rNpMUn|#kdgK+{kRs*dՙu11 Y!`>Sa2?.. ˨d4C?!Vo(4{+LS3MY[[:}CwyY˙O3 V l IhoTⲚM.+KiC)gyHzvp|Qj&x"hFU0 d.@%:zeڮ[]ou$vS]yd2B3pWV񽿉<xơ]?eEq"\Hڧ-[/ q]XK;o \ݙ#^.'6ڲnu d \vZՈQىY0 'qec<54?sĚ]i:֘ [[}6H-UUym!x[&y?C^h:$ 2Yr`I>`fm][ y~E{JNIXAv X`v68/x^;=fh-VKh՞+ٙw IĜd_jg.xm5[_yl.Icm2^MɂsOD[]ac4R ҥ!r|˴>˫麵:]Ωn!-펛u$,O;v2ޘZ/k׎4.\j]2FKYG",jmoDc F^ H#$PFn|oXZktHw~)ia.§2}.g!Ԭ`ѕf[˸®Kqۜg2V⏇z{-o0EL(XD2:vaVol8InW9x;GsМQ^MyX٦`$#s\ QGkkռQY4w~=jze,Ld$B8=E~|MiW}Gvy{~t<[[C,FIO'5_ 5_Ʊ9h ~~jS>suaL͸pLt~jɚ*m GQ3V#3ސY4=~ZUdߞi|b3ɉXvdr}A@ߵ_^h7lUYG(>~Zn|t}ր,Ckb=)IRH,vzՄԐN(@ *SN@3je9"uf9ګ@%g;Z2zcI~sQhlp1P5*{}( PSLYd7n?LߴW2sӥ:g?Injۀǰ/O1V`2v9LyiaFM럭 QOF2O@-)~y,qjr0y*B[S*;%;[˽v^\@~q_"NwUfܽrs]$:2Oι_ "UxI]ZU >1P> |Ms bw|QZOZgK = =;qVE#lg4R߷֏''?4w={ہT@W4AO~^ӌPG)K"e1:ڇҠT~g]]glڰW l)ƝoeT/<ͧ;V͉W`k$[HniRc;Q$ŽxMF5"\n1 ?5/uKYuG"pߙDqSK Wۂr9{략2?Ō9%P9?jW#L$lwUCNk*G&*\~nUO3v@ {ةBLj-"1#ǚbګ#}=julE+P9-y~atqn8⑮2ON:7G)fj\7;Ԙ0H ۋ6[+>Gf,k:4 .Í!?xSa {OR3u# O5<ϳ{Ձ,2+kwKP>h xmA!֮AyG;!ȭhJՔDqJ sR\ܬjv*#=^=&SAM[)jP}hhqPz7Z :wP]O>5-h8wAgVD}kiZvl|ignkk}qZvVjGހ*ihEkCS[±Ui}(&UQ?WfqGy7!>R$g]{p듓jMQՔ{w["ĮzU;_SՀ%Y7ɓAIX}dzׯ5.|֧W7[*'nevtʈ+Qk5 ę___ZevhL sNMsj8eڦw;\C}"Iy?jֵt.klqcWh/N#x}SOl{{vԉy$QbխFTFםxđ]V}&ަ7 36:}k̼Q]FՒm\ZYGjMWT/"\pxWz-L>Ѹ3z}{ӎ jlYZMpۨ_ ^&GlGf&aK;5%~]irNXҼĞ/,iv(ޔE<5?MҼZ]\l6żm3rER|O΃"Oy#Í0'UVMƄ4PLwVc\Cy%ڳL6O^w*+sog{U eie8ӵw |0ť[,3OΩ冢\̳} )@֪ݗoӵ(䷚20=;^"M^<~q41 >r/?Lס xOœވe9渿‡Ț(YO](|VδVm~DaëgV<%tdiևŁj|4fPu̩|]ΛK&q\oT-zdž9%oȯwwq]^ȷEaFkڬʹ ~'hZԯnEoa{~hx4Zͮ^$Ј ~V댏j;YPPnr\$^)=FQRUݜ/5 ,דn}}Ͽzr(P}?NKKpp28.|#coyE}solR%yI9֚՞Fk{(llԜ/sN{K7tR{ɱvqԖ,v[kX2z^N8 > ÀNgZiRKXf6!AG^I|&/ᤚAQ9g]wtSs+C36 1H?.T~"+Ѣ=OS[>|=`݉b3&~g^14 ͎%5s8^#$LfѼw2j[]{J_^ ~Qv"mǙq/ 2c8L+XԼM_^L.02ǸDXxa滫xk6E$Vե$sfPx Gz ύV^dEo b |O\5wGM\Ծ+nteQ\0E۸M5;o{xM/tɮQś.oѷkyP;itsPFϲE 2H^9`8fSm9KG0cDQAnpϿLT?cψ ~=3"C+WH;A*OxSZ\yS2Y/&?E1kաm0+R;)9'RG49<'=u-v9;v`һ?W‰tBK%]{{-;.fԦSUگ ;[{X7F*xAMr?2 #嗞Ifxl(#R@',sb-3 %)kOmm4xc |t־\G{ƹy2Mt鎫 :@񖘂8t>>H֟Y/|pzNz,2#j ,g>07_1@֌<ԢZ6L_VfŖz㾅fhؿv 2 S9\|]6v2^Z>yxl7eIcrUTbZ +0 l|@} g}i1{%^gJLe"(UcpHl`y,.oGm$լִRR6IX,+є1^Cxzj 42Chh^!Ke fu ZԦ쥽|'g~Ohm_VEiO#: ky' ӌèZ^ZZkV^im$Dk1#21ye7q:t)ſj /Io"GOC !0PŐ~}ܞ>K_G#y3Y *ٌjhLv-k{[YJM0H5wu/d~ߣYG,sk͌@U9O= Rw&RkS$#1Xąd6Ax ~Z^ myN^4oTF1Z@qwR^}[@[LIt.YlMBffyd ^C<Ka-{ -V+u23,#mc|< }Iuf-k& l XʮʞqjW2E!w \4m΍wAc@ؽet۝-c\DA?76XchaqXfLP]>]'ΗPl=mocHԽus9y([;;[Y"/f#V`q2M Rʄ e_61iԵH5hKp gvF$HPv$7G 2^[ǚ亖 XG{XEk&2yo$+[%]n2SKi5KVt`RWba,hǙ#&T)uxoڊN.b. bvAB8 WY[Ú5Jd[+QJ/;:2I>wF/׮ld_F-dX[Z}n&4m6@dn]3<:U5$\ ,s(.[<׫薶fmR+>G%MISo&ܩqdIe]\i%ż\ZY"$UH 9UQMxKY7jҤ&ܴ\o/ګM-6_5R8Y#?%b6Xȑm=/ħW.U=zl(%Y >O4 |<;GLj4{[_k:gG[\\HUTH % +chLcu^-[E"_4Hο8Pr70 T|#OBT&&cs5 dsPM"7y"+k%a$ _tsc>G/,/X2saA;;*)mŁ,Gɥk|<_krVͭc)qpJX)x~X=?Z $ 4DLE+D^9гxvCى[GkV%N|wX7jb #TϯgzȱXDcXin ],cU^Y:Vf=f. [<_wqCxm <o> ӵ_kfH|DPBґ$zߎMOVդFyàjV^!-fy%ߗ"M:7ēyi[R'8`cK+e x#M;o xW=}K<<J|7$&X.A\ʓ|W}f _ c5&ɛkpWyd `>'P<7c'4 [{}Eo&k Qn'-eTAm^k|IMO f]?\&H[mg[y[qm<ފ䗼EOw.&ntc gY@v`bFB@e%tB9h-Syƺܒj1$e a8|ie'nZٴʍm[mˮ q$v UsLUnMi95-:4DT'd0HI,ve&tj43]JAD2$Sq$JHVšfYzk&hnP@2d)ygce?TY|+wM8wO.-77/i,@$ 7 bT;`x!X]H%{i^?=Pk'è,NhhYN»qea8*6gkN1C<0>f% `Ҿ+:ks\ hڴ_l.ȗ?wi' | q/`̬vwh/"6f䝶S֯5|a*ePR0ۃy&kޏjWR_Z۲(]NI0Vq *@PN1y?\o/Z-=0^5iR@=c KKտ2]և=mt#@%Ur>e+ fP׵Q 鳠MSK4 cc ڬB#˓q:]彞cL@f%b!) |d gI2"Wq|+ ׵KFq]Ic>4qr(츛9TAzMCmʊTF%l6 !=e[EX}>Hf?o;oycb38RFtw-mWYL~c$Rܛ>v']) w?jct[f]{Aw sVnai@$VCPúƜ+ug-kW>d\g>mKxjHW2iIy5ի0T#ߖr[y#<)iWWj=Ƨa:FepX R|o:>bʙ_v66qy⶟OFe!oB$NdxMomz|oxuH~Аn*(cGKRU+&̻P:,"'1gaMp[eTL{co}f3]yZ"9dR>͓񆓩X}; Eb,nb NB).h2U9H"@xw8XѮO0Ǽ$in @'==VG건$2yrVNx9^ lKXe <玕ZEtktWEe*x.oFA=;&\@JlLeGXsO=*\ґgO6{S~?sURȬO ҤRA}±5cӌbW@޵m'Z^vzŠh?7QY6c6cn?1@ϱMi';ý=gU_J#(_5N}6CNu㧭W&-bGA+;m4$ ז};<ӝd2[+sRcD288\f)Y=fUBS 2#\eihS\#ڃ*6 z:T#J^$nXj[稨ZM/8lcր'݀ru+;1ϥV I?6Gx dt%.rrGZ;@=}i Zry&G3gph4Ҡ.G+4N90ߝH =ޑ1t f|tn?|JscRϷJ0jj1&ҙV;Fr?0+%Ie8?xzӄ z9-@ gcIܿ7^9Tq 8 oɵbxR_ΟK,K}^Ns@G1JֻqMjco|?J(l˓*KD꬝[M̼7^d\搻!~"-Zyg \R;)~)Efu?j|mznSW:5 9*Gk Mr⢊ԩLԤnҬF%<)y#Z868(m^h}5*_xX9B\ddv=4/v'ެ3P\ee\ ϵKח oq{#EnsRM{;`Ƥfq&D4f8<ӜQCf*u(-[:*yW*EPQ*J6&{ׇ6ۻ?u0BW!HWҺK}C0ނF%'sQ4|n~zV֧d o>o=*tVWNL\OJ/ҬNkz~gREy?M?B3&A޾vNk]Po"9=xW[kWC0)կkh}#}8+ѻA6; J Jŭ&eV ?dگ,V57i O/ xZkhKmO }x茛VC6DlÐ;~u_\xK+%_2$nbN^ -U*pW׊]{0 ƞp<{qKFW-cƧinrZ0Bl1C+%ƷVPLr#QϽ1Xմ?,j۱?C]fXCKdqZgloVy& a=v>x-cTgCMص|I$pѝ#^'t]{5'ʈps׷z,9E~-Z_i+iF$sFXĤ63M^}`vYNcL .tpaW}KOWvS%䋙rB $wҩ"\-Ė6N>S5g.|+|ꐹ2v+6ᦑkhM@l2w^ޝuR?x韝~[_׿b!xaApx nh8Yy.$|F:Z &V.Cs_ǽk8Ǎ;fBc&`9$Nr?*Hl;xka\Aq5J]oKLUkIe3[>z i7y1ʒqq^y67l|ڏ;h@1ױ潛CSxF!8T<J6D5o̹ UGnj$~סзP +Oq& o\hI|y킔E_bnkV>Զѝh 9tc{I5چiWgzw3 quZǨɋPIP&/~!àZulIcjV .X9𮼞,H[,ZMغذPyb3m.Zֱiz5s$H̃..r@\CmޟxVKWSʫ0bzd ZKU_y|ASJ}hg57, 7c[MZ[$3}Pm=?][Iw{dYaI$74,fGT鸲vR0GWg.xp7xyn>wxĶ:uKu!qL;5!~(o5 2KnrjN-*=ώ}}oks9L$T>^t70ճT %$3Ni Ud`2!s59#{]Jl69e.ʋknrz~?g?rhuxȝOS֭h<'j!8$.'dc89}5 u>n4f9o,gզY`mӒz<+&aKE.G//|DOYS*n(C-6 jeq4z|2jBA Yp2|lxcׂ|R=՞5^ FkRT^8.A'4x'}⏇jV3 ڌqhU78Qiq+`9" 86ggŽ464 xF,-/n[6+u(LĺcigVs]K}:%M[JGj_Gvc_ =Z\ux(f[Bmrvqdr*x[WTF׈4z9'O%؍?n.͕rpA<D} ٟ 6&5.ZCnn8]&ͺ%T70sQooZOm&kkc8O>bomJբ6 ̌RVJ$[-[8<.-*Ɲ~.bӯ.ei|'RP+iV rH77|EjͧibM6yQ~1Ɨ qi~T^5+LRP)U G{Wŏ3[Ak[w[!ef;#a &PYT!tۋJq=? )B϶h0{WP+(x_5fB}[LIf -[.OQr# T3z5+7jȿ7D0췶M겶I] =x? M Z_nF s Pd)BV6,3)+x}_kf6H[yy6Ju/57|3x;úNnrkԫ1 (XA_N \^GWHL5x{F.t)PYH~ֶQ0,UdvT~BT6y?漜@}aX]&W';F WFm9E+}6;HL"oӧf*6ڌ0N4(߳[_ڋw:4Cݴ3Aq%fdF0rvU'}KVh4l{XWDDΩĎpMr?YSoX"8X0x頶$񽎟u]G=&r+a%\kq$ȥ[/fW'4 KHn,n2&*M?XP-{{F8.D̅f?+7I @9X4k7:e:nFw4 $[cOpe%Hެ|Jl> 7yV-|K+$#)A64hzɼ&9ehE}:ڮFgk[[ [܆Qqs)6v s,o&N z5 VX 0tAͺ(r^/W;ZzfKwjTBD,@vXGk}oLt?mGgNA ynWň}vMV oG}o[F,`KZG`]Ds1uTc,Kn=3Ğ%jjűnK!wI eK&YJ* h7o,eM{}(brc  ßsVOaķVV(ff>cĤF} '_cPhF9kgr2l>i0Zݯ٤-iB,aQ0vnU[1ŌR'{>x ]6>+[?uTdNώajZu4Q#Ǔ0 DQs^>ehƶGO!%( 2c|p33:mOAi,qkiNXcXWrP©6v/I7Aڟ4ޖ٤V CVUrH!:g4mnk{˸$d\yeg?0u>wLdaUp [mM.N ;c7x>2o j] %AIuq+;NF` +8gcMN6-|MuK=ŝM3+xgpJ02)h?Voۨig.c0Sv]Br8^9Z qQirEIyŮ|f6-+!tf;NN2|Ou&n5;K[Bg7qm+G[x2&7HNv*v.mc-;C,wsi,P\37 ٞW ݂o[ƫeckz~ʖjIm9bUU'9OX5kyN F mwɐ:$֎2חQH k%g mN1RQCM %Qi_!\zwg>^"8_րo?LFմ͟'4XweT qߚvŗt_F˴u{()RI>eR\xP}?J@⡑swKvQeJQUd.Jz 7V1@~<҈;r_nCx#sC&ޮ1]EgV0OL`/NfUc ( 7jP}q9QZk2O4A*F͟ҕSicM}i-z{ӣsp߇M ހ)*sEgUqM08 vǷxɨ6ң34;ޟZ?RyI52/ ޟ'b)A5 jhW+ " +Y@J@ ?3tZanx2fNȠ 5U x ]puO7Pmܨ~~P4Eҝy(8EooZGc_>v$$Oi]/c'4\ Ԁ7L~7[&{u}ivOo{ۭK?:RC=_ƀ.h~hf?2L߷hZ|㹠:رB^>^8#G9n&ѿvSKVL,vg=S .;_ qQN*xbӼ=FnUoR4:tZS($.sΛ}x47(n:wlVc;ƜT:($l,qN}ӷZmGzC_ր*8;ȧ*W\8#PhVqsi\N*kctVN9'c0-]S`hSN*7vq `YBLS5^[\l~m;bzv]X{ŏc_zapr~>&^S̭Q7(4(A,S!B٨[j@N[%Xfa׏aN݃UP<~jJ%"g*Id$ǚ8BVM (=mb:s)_NYOP<}魎v4msޕ%QqPҸr5|Tf^}*ds);b֣k}ۺ&W?қkqF]dg֫U?7l*FUHXR(* |7Z!`x\ss(gh uFy=:ZV?…&@g֯4~Qa+wb*5[8>G5`1FHW3neѯͻ?J޹ ͼC 8 ӧ^)kKh3\G `[ ;7"Lh]>5Lo䑎1@RxR?nyk-#YdoJAsqhud& I&GYC6:cuv4k>E' ?JЂ +"`rqg\㧭MO}MPCw7Z}W6q;ѮY?"c E'dolwycx-0I ÏH~b1*[$ouͻּZ_/.6-X~Te3Hm^2կNReP$hn/J\X6fYO8bgKOV8U\cw6V_st#\pq-#Ey 2CuOAS=O_ǨʫoB\+)KLqcuS~u7kk=b=?Guq<@u`_U1ӡ1"j:¢He ,ec|#oPd+MO]^K};QѴ}=fIijώ6W:]JĘ5O-Ƥ=о]h!;c}&SF9O6a,N8LcSO^K;?ؓUKⷙ6XqFĝq\~}1,q!r;Aȭ7U,v)C)5AnnkOeKCˣs?JH“iv6񵴑IpnnvZûrm./(y+|nGU/~L6k][l>ѸDe|}Z~.Ik65, .bj"-/-=!N)sZ2]c!\o.^iۭZ?6SuOk=";29 O^F+]4QD,%/%D|=V]KxF^ SKH I2I$}k#u clY+5nB1]oM1f(ؼl:Tr[i}-/$GudTvOKP[ۿx$Cn3DJڻћ=bK}.K}6Ly-?:TMv)k\"Xr}HѱYK/ xVu6Rh![Ims#sx[է5 <=q۲F]1i$rc^q6~#k{\x=B&YŽXyYڰ9ECehrĐ6? /&|En:jeSOwVHgB(\Ÿ Z욽vsxSRk $k12őFF45/xŒxBCFfK-^[?1pL+蔃p Bd?k3Z?u5GHo[N}?, &Eʀ_9#5>8(Lj< x,yV&UFT3ߴj[ᡴeX@UYW*YcR2 Wx~/`H>6Ԥ>~#f#4wF]ƫ;].LY绳fi8#ʲѻh+\ZOT?Ƕpa%3dv-7͢cLjаG]/OI `*N1[Gš^Zvq< wß ?n-$p1F8X^F|#6ct:Ygi,5䷔DV['zw$i5BCź+&[B&+䍤f.C`bͭ7ͧ}x֨Q%f;8NrW[]^ #H0&@P uxUO̺}ZG\/ɚdHeX,Tdp2 Dj]լo˫!="&bXJawl/`dkMap4;O-cf4Ry5h#Mv6me=ռT WqlY>𥏍|4v"Tw[M3;nw/:׬irYI} vMZyWVo QtVr ]y?9ۓz˞uK}bhdi߲7$GNC*[d}'lKPѼ7-%~j5`P˒WPn]6)mGPZ}b{5 B?gxO.t̏\ְ,qhR#aġC:hgP}M'fq >b%Klp o]mook?lWqg%ąLq b7-V9=^{_xf}WGԵIH Jbrr~0܀Mb[k!u.iAeAxbX UY/>1x^jω.W6m+#U; / xoDt;VT s$ ul{YdP.mp dddV[jD\irXŻ"S,18?˻ŋ5[4y.-dRx- J8ڤ)g4yBPBx^zWC^ H̻F\}܌̿o<*.⿿ۥݽ|к3ӴO` }Qn|iVpFoy4[7\%RT)|3~Ӿnom =do-L,z&cHǫ>t|>r^T%y  J_,!;Ww'WWz;U>f{qJ@,XLHNvf?:m@#-%w;W(ʃi#-?w8?vZu.4]Y"xu[©3?ڀAI!r=Fヤc[9#t1' 'n=ƏXkM)!BROJO (՝{IŖR׵cZ$1Ӵc߹! A,x<5ڔZmrä\E(")w2*g8.QvZ>^ YӮx]"5(cd1tN@ý?CpŮ/Q}aq\ϥmxH.$mdp:鶓]vzmOl`.F6՘1M[ax,[=&E$O陶+76W[=>KbCOyn$Qo"%I':iֶV$Z :<-0vVm3 sd0/Z;=r6kAVB "NE6ʗPBfRI,vXDaԒ^Ix;V+DB(T)-+rgiԉہ#\^j7)Ko,dRdt $@II5&ѤӋhm嘾2 mwZ]y $]MIC;"*-A}.Cj}Ʃ[ًUEEգ;+ wEȫ^ g.OPS4 ji5_\KD%fa$ޤ+`r &Iywl]xЂ yrr2g'u^–hm#o& 'hSlT`e p8&kp>o:÷ y6pum%*c#vIqz>f~Ϣl!Ԥb#T<M>X ?ZΏhc䗷^S偑dCѕ=}_O; SIaqwk #wby,|(Wfygttk{ jn,,"{Z]W!hz ͩkjjXژ8$tc*HJS5M dnb%.%Va Susjnj]ԍ$hh./8FT͛7rH8 e>+mhΆEz$%FF6@׼#GIy7Hy̮9dWcXx|B-P&c5=r2|ڔ.-QZmy#JH"CfҠnJ\.mlMH6LAyd8!|è$qxk;u֬t.'1݈r]a ]*qҴ<%V:̱YeGd$Z:$6PCU~j]Q帚;H`m0 mQ ;F|izo74Q=ҩc]!Pl9L5=&ڛ,ֶ][]Ip)9fNd Z H6RCo~-#Id*& P~%6Wlw)pTtR|l0ɘ qq-ljSyMm8w1O$G-ԍng:#h7]+.rYlq9f4;mo{g5N6b0$tȭfdk.W*`} }+#Z_ B\I'Qo^'vx;ϹP[b1v69Sݦ\Ct&@/]F1q=k=/*ֶq^$ O8CSAno6.eyKrOzfϫ?d-quo^G $v:m8:~rwktݠ1F9Vfk: gX|sr7wkugkT.AlߖUU߯J0i7j׋XK!ͭ+qT/5E'`Z"-E=n3p>;X7ɺ_seܹձcz(j| \POW>SaSpu v*9*hLUĀۻ>ad_רeT-+Iܕ"2s@13׎ԂٓU(sOO>8xM(O ӽ6Yr T+<2qqIS:,m3C6;sTILwU\6:"(>NU8seր!R;z]W`T6U%TG_gw+e!Z{~#=ɹ',? <Z(uK^1k['W_֛,U@cӒE^˥s)Tzs@/cxJ?O [UmVVbztQ(#uw+f)J y5Enּp+Յ\FFk5~О }EGrTJ,{{zsUUUDԦm=5^D#z^`toƪ'j+zJ r~5wO8EIcb7NIF|݆Gi{]h&?|k͎_nrtn5@0oµVt7'GֵǟAq?$TGJM/YR֡UJI%OZ <4ɦƻ֮GoeqqREmҬ-sNě*Ǿ/J`#1Fxb^ϼf,1?E"?{fJdܹ*%)'$积Mx6߃T0jQ(d_Qz֑2G=ꬶ{;۰Ms9C#cu;o>eu1܄D~r::UQz{lV3f\vqg'6;qG"w5D/ϯZO'[d}E11_|ԮE֣6|Hg]6O:zSbsv{#Zlv4% K('IGngjleu4&X`Z?zh V#OwlqDɅoH})oe, BLRVo?{ʡxqR,}hV~Ym{zqRМ~tX|-c$ ƭnqN JrAO`sۭ֬&&WTrD@LJxƙ|)e=)Q>zE~F{ZF;UsEPI*Iueš y&jϚj_sOf35\CzƒiL~] ޤ ^bi0ԛxl͞<9%7֯ͻ~zS l:Pt?ڪ=ОftϽ-/>ݪE\֦a戊Z;یIr*ּw!ƴg+S5J'>cebx6.GRD*w=sRC3/?6߭r_'vXܟ:y#=O}x Y}Ks'<3QeKDV²D)4_jz]G#  {5_H59`rNp2=J~"ˤZka?<G+y&ukqmyJu7:~sIJ1Tu~9TU謳"V%?!Z^մnMWLhѕp۳r_JA_j6(IY2tcw/tojے؅ibb=V՝٢/1R~?[/Hh/iXv9()nc4ge5}aPpwû yoc9/xr@]fVVuvb4;;6[xfHd~ʯ^it얾dl;L 3] 6NfS$sw9$vu7؊=S[x_Œnd%ׅ&IyQB󞠌b ŅԷI~NxxV+6o$`n,k񽅏t}YU$b{ԼUqXi$BI`یszuw Cm[@&edg+S5YX'C9ANS?u;&&#ڑ#ǷPhe闺yE ~^j"c<:{#z3Z~uptwrFLFPFJvͤ^Z$ȯ3Oˌc^+׼/4vY]%s@H^Ѹ'ᯭ-gGʲO868 ~4`<5mĨ~A둜u^ ^Fsi˥"JXяr<gK]cQm E5"ݎ2vѻ*:#e/WTtwhN(c+s]LNi~85MOPB(dpZ5L@PŸůUEsPјj7˒neV\(Cqokj{WO$l P ~;XRσN4E彺mȬ~[.Gq9!.6v̿&JsWx%+ui[qam^J?,t\)<텧Yw_Y꺧K&u' WwˑFێ܃^㯈m ok[S}ͤ(@Yӂ1Y~6w^mZmiV\%trIh3p ouK{kPxThWV[dݼb5&;[swtMԷvP Գ&>~CD++XQ|= F=K0Hm1H$ϱ>i$&yO6¶ucv-U̓/&IU6;I5꿳擢xwRi:ƱonRY'UfgLaUTXkA}"|>_KtzI_rdh{~Kh,-<܋ 5zf+^'Q&oψ3_.dQ,Fһ@c55mIhfkc;FPΛi7~lsYͦŨ6Yq)~'m3G3{|Mm {}CKK8^aC73d.=Ig!]%K}J-zRxʑCclU=۴+M/I%#pέ 1y/m+;=A/Xk_>58HWhS'Cװ~NtnLӛE؟?w39O*=JeƩwoOkX]Lc&m?U5 -ZVzᑮ6 `Yzgg, 5e56,RT\DwS GoU$v\+^-SKZ 'AӐJ弸0˖P9r,I9c^$!Yjk++,+*J8t?3($q(:~B=ila$d1"E &/>RG^Oa+lY ti:lzf(cMQT$R2σcq:lNŕ:\lվmxKCC4Ǽ?&s)6j(glm-,!3'|d ;+ZM|9yciY藏%ڥ9cdL:\CBCmy)P 28F*xTֵ5l򯠝 ٓo^T Iy#$V/muo/-Im/O[n.#`+G[pNHo>o}K q*  pF~S\om:|8zZ3^DO<2I$*Ϊbŗ"F<]潢h:,hzƅᶵޡsq /\\/i=o4=CPC"+$;BF.r/8iuYu]]2O+]]gtxG@54cߝi!.{24D̮|~RlQlO~6 P [X3aw\pkm?~7ӥ/dlwvr+)uW*B0ۥ#X%@X & G<]yzl G,ri6 t?ie`b2? \GZ'Ys-bKKTHVv@@WFIg*k ?oXy^.mDh-ZXrه̏:Un5.*xˋTԴ;AldJ^9#!l mrrIǚ$ӯ,=ch\$<.8kzU-$K5iou+IDgSC2cUj^<]gkr]6 Q*D|NL7n\lփhմI{K{hMmTa1;cg!!xɥ+:xF9ou)Ե Ρo{cƒ3iXʥv>1}yLz} o&g$JR9qr@.@0*5Cjݼk Gccd09oħsg98LbSk-m\\S eu%pe ¨06%яڃ^X_g{mV6DXd \ $Or\kvޮUD \ۋrX`Vmi x-mIhC8-;1%>$Ś?㼴5iPf 'ڒFAom̹ {8m 籲DWeUD}2γKouB_^Ar_ôN#f"9 ;ΨN)gڅt@ UrA V LM4_sM[B|_Iw4~7E+}4; z<iԲ4Ż=qҝ+}ҺmYV>qjJ#sM3mm޷mt1yW08j1^0@zU=^J۳:z"H|>ߵIfU>@ǩcc4Ɇ 8Ub}aOMig摆zBs$`GUjDo^hVS~͒{߰uo0@ @O8o0MNԍozRP$j͵/_Jc.g:TbP̠2H-ژ'Qއ]N2F,~t+J~\Quq]|iO~hʫkJqjnozqC>[ bPu$I{I{*88_JH]Y~T4x_^Tssq@"WVYٸvԐݬ\T޴#@~)wN`stY| k~xUv%Wc\Jt?{UߜW#w ڀ'`tP3\v[@*>fvӞ(Iĕ' T !c(<~>T=h7{8Qp.1|tis:ӣlysMqU6ksRI{h9+Hڂ=('k :fF U6N{xjWAi w& ךrߞGZ9$vi5@"@NzTR1L|۲((҂TvTҟT/4zʬ /O=ZW`B1SMŹ4jy< c&>pQrO qMTb{ ;j*x%2, "G.zب~U6rU.=hB+?Js0}j4jgjY l׭@w zg5F{F#Nc~)ACۏl\3(0E#>ޖ#J|*\*NOJp}qG024g'8 r}ei+}8&L3qTU# L{0=io5YOzcQ>%O7=6i<*ԒUǙfLPk^I}i$<{rjK[PDcIwץKkn1a㰦4x SCZpv{PwhN.W;S7l$e٠ zyNE-ǧ֮OsTt5\N}1IC=׭^[s nj U^拠:;MQ[|֕'GZg|۲(3;hhqv4Mxn2ic8Z9? n9;ehvG4ʩ֪2oBY? xlv@kk [#G$~f ߴg5q 1i6`OxTe@<`WF6U-Hze47`1HhAi,Ow`s޼^ĚlmcROJῊW1…c[8BGy+RÒjqR W/ן_Zm pM{Wh?-[d"6)|WxBv}!r:Ny5M7F7ƕQ.}8C|!.$E^En$o#jG2p+?a5ωۥH<H>P;``}A/>$Ao+K<+ßα5{Qˋo++K$F3+7k#SEheݳw+KKnbg};ZSxIՖ[Y.?scQ|`Ӭw˶I# )g?N:׏u[;Xŕn.fb?Ծ&@Eu42p>e 韩SDYQj! ﷇ ǂs׹x=hX4Z+FP3QxOEt|@78Hsω^"I yr/312̋=NԖ+U._,H]GҽsNn/t\y5ɤ;ky<Ԇ7Ȍ VMWߊ-R_Oɞy'&r=ŗzM֦F6F~C;k37 GuiridwW{St+P䮥Gdr&ǶkؾQuΡ}JŤiޟ}kmoHXlnjcgyahTdcS:ݎE dr,l3A <lo4/!v W`MvAV9S/ټ;-<#h6~OjP@7%Ŭvk㌷lɞeh`I#(u$CEVͥ}ͶG׃zT~!յ3!l}ׂS5o&I.la d\%xWM񷆡>x<@qM^+{z|8Dknv`cUXWlK 0p0=q־}RUm:96̕zքsOp^;! €onjO EjP ckfW=nҭypCwzWk2"۩-PǕo󊗰we4Gֹͯ>ϩ]i_$j$hN e8=8kTTDJkk%`eϩė5 #MF) GPݏֺ\h6X,q crke_ptރ3&sY<Go6ЉF9מj{K^I.U5뜌~YΉq Ɠ #2&xF0޻M_UӥXZ}hh>TRv)ZKu$kgq:,Lm-H=6/I7躶Qr*u`@rO82ø$ţ6ooS"smrFq\|r/4{ CrJDڳ۩N2q'2* :Ӿ4D*DC A.t$2+o^G~:;P"%amJ+sOXӔXzu.%֛6aq/!Ϧߚf5 GYX[iRL `j  D~s?d]Kwt EGgr"mus'q_Wx#۴}FKHn#ž5ݥ].pkStWZ'`ư`6 I#|\]W$qnk ֙uѱMwWFΊ3fĞ!ina21=E&vs.Y``8 V$\ѵ1I- Ep,)!MGv2_w\֯tkK XOЗV級Cqȉ J6AȾ ]_Ai$vظX%HΚC<,3T{_x/RH;"K*mdy̅QRU]'V6f&'3 ": Ź9OA55il/lXm! y &BNs`Vгk;hz{%ܾt,@x9\u3kStzK:gt.C@$SwxS[[6n 72\4J.5\iz7Նx oJ zniGCgGu3o_G H/}{ zsy5qMZ[;X`B\~.pW^j|=L:e߈ CʖPM "uܱŊmXtK+HuM=t)KƂcv*DiPwg w>~^ךvִm.:oo̗8XE + g3j֥~n<9Κ̺dQ7yj RYյ-r(ncX3Ba ]cNcY:a׼3v!nO|u-3w!6,~jmЂ$>د\my5VWtw+JY;~cQZMPQz]Ƌj:֯wm5žZ+xZ7[O[4/bXF5%8A%9?Q2ZӾjEM/`xCg1#ŀ*k__VrIMIJF]n6ܭd H[+i׫uf!H0,F_9l; ɤڂɩi*iMX Veɖ!\!Lm;Ey7zǯZ[Pir%dh]' UTVT(jrjeēīojLr!2X)9xoDOkIJr3~Y p"=*Dݖ>)xGҴuOXi=oV..^o)6s ڔlO7d7/0HEG|?,9㋍N+=ZMNKhK3$zFlRyl኱ГX*,ocQ.aFHpX+09+l\WVv:'.RF2i] f3մ-b=&R "~s<3;AnСPpTm?hO.Ž zkZHHY FBT qfxPpm2N (dfs  mP뺃[Gn-VfEr ](';Bt7%ӵHMB-awgo}37*k<S⭗oVw=tWwFSkfMP& 5s~>o#kR;#m68R摹bFTƏ i֥xnC]r7nrV93ʸ`_@'4#Kv /c魮gnYĻb9wnMvV~ֵkk nn-;<>`CetڛܱK,Fr`1Sh>mo,ú[[]_1W;U`1$eG}-'RhPMjc+6f74Cj%会wO! B()K sչO+RFkkUE͆sQ̰8bHPʹruW#x&RTMRK%wb\1cs\ H wV{q<@ kTI&}^G*.ct՚9PI ˒V~`nG